Incidental Mutation 'R5868:Fggy'
ID454266
Institutional Source Beutler Lab
Gene Symbol Fggy
Ensembl Gene ENSMUSG00000028573
Gene NameFGGY carbohydrate kinase domain containing
Synonyms2310009E04Rik
MMRRC Submission 044076-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5868 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location95557507-95926939 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 95696988 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 35 (T35A)
Ref Sequence ENSEMBL: ENSMUSP00000115859 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043335] [ENSMUST00000079223] [ENSMUST00000107091] [ENSMUST00000131654] [ENSMUST00000134012] [ENSMUST00000143742]
Predicted Effect probably damaging
Transcript: ENSMUST00000043335
AA Change: T196A

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000043460
Gene: ENSMUSG00000028573
AA Change: T196A

DomainStartEndE-ValueType
Pfam:FGGY_N 12 268 1.7e-29 PFAM
Pfam:FGGY_C 290 373 1.9e-14 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000079223
AA Change: T196A

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000078216
Gene: ENSMUSG00000028573
AA Change: T196A

DomainStartEndE-ValueType
Pfam:FGGY_N 12 268 3.3e-27 PFAM
Pfam:FGGY_C 290 498 1.1e-50 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000107091
AA Change: T108A

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000102706
Gene: ENSMUSG00000028573
AA Change: T108A

DomainStartEndE-ValueType
Pfam:FGGY_N 12 78 1.7e-10 PFAM
Pfam:FGGY_C 202 410 1.5e-50 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125742
Predicted Effect probably benign
Transcript: ENSMUST00000131654
SMART Domains Protein: ENSMUSP00000116264
Gene: ENSMUSG00000028573

DomainStartEndE-ValueType
Pfam:FGGY_N 12 82 1.6e-11 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000134012
AA Change: T35A

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000115859
Gene: ENSMUSG00000028573
AA Change: T35A

DomainStartEndE-ValueType
SCOP:d1bu6o1 20 107 6e-8 SMART
PDB:3L0Q|B 25 110 2e-24 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141248
Predicted Effect possibly damaging
Transcript: ENSMUST00000143742
AA Change: T15A

PolyPhen 2 Score 0.853 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000117386
Gene: ENSMUSG00000028573
AA Change: T15A

DomainStartEndE-ValueType
PDB:3L0Q|B 5 63 9e-12 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147766
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176162
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176840
Meta Mutation Damage Score 0.5202 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.2%
  • 20x: 90.8%
Validation Efficiency 95% (58/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that phosphorylates carbohydrates such as ribulose, ribitol, and L-arabinitol. Genome-wide association studies in some populations have found an association between polymorphisms in this gene and sporadic amyotrophic lateral sclerosis, but studies of other populations have not been able to replicate this association. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2013]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810408A11Rik C A 11: 69,897,575 K394N possibly damaging Het
4930451G09Rik T C 16: 4,974,068 noncoding transcript Het
Adamts18 T A 8: 113,777,748 Q80L possibly damaging Het
Apbb2 T A 5: 66,452,096 K69N probably damaging Het
Ascc3 C T 10: 50,842,183 R1991* probably null Het
BC035947 T A 1: 78,498,323 N524I probably damaging Het
Bpifa1 A G 2: 154,143,876 N37S unknown Het
Crnkl1 A T 2: 145,918,553 D648E probably benign Het
Cul5 C A 9: 53,658,673 G86V probably benign Het
Cyfip1 A C 7: 55,926,313 D1077A probably damaging Het
Dennd4a T C 9: 64,896,729 S1117P probably benign Het
Elmo2 A T 2: 165,294,272 M618K possibly damaging Het
Fam205c A T 4: 42,871,711 D221E probably damaging Het
Gad2 G A 2: 22,685,067 probably null Het
Gtf3c2 A C 5: 31,168,081 F455V possibly damaging Het
Hacl1 C A 14: 31,619,916 A311S probably damaging Het
Hist4h4 C T 6: 136,804,294 G29D probably damaging Het
Kat6b G A 14: 21,634,479 D611N probably damaging Het
Kifap3 T C 1: 163,865,472 I611T probably damaging Het
Lrba A G 3: 86,319,604 Y683C probably damaging Het
Maats1 T A 16: 38,332,242 D202V probably damaging Het
Mfsd14a T C 3: 116,633,750 N413S probably benign Het
Mtmr11 T A 3: 96,171,202 D691E possibly damaging Het
Mzf1 A T 7: 13,053,189 F64I probably benign Het
Neu2 G T 1: 87,596,756 Q154H probably damaging Het
Nid1 T C 13: 13,489,157 probably null Het
Nod1 C A 6: 54,939,327 K128N probably damaging Het
Noxred1 T A 12: 87,224,202 Q215L possibly damaging Het
Npat A G 9: 53,570,124 E1044G probably damaging Het
Npr1 A G 3: 90,459,493 probably benign Het
Pdcd6 T C 13: 74,304,014 D169G probably damaging Het
Pld3 G T 7: 27,537,668 T262N probably benign Het
Plxna1 T C 6: 89,322,722 probably benign Het
Prh1 A G 6: 132,572,211 Q227R unknown Het
Prtg C A 9: 72,809,717 Y113* probably null Het
Rbm27 T A 18: 42,300,385 V242E possibly damaging Het
Ripor1 T C 8: 105,616,004 L198P probably damaging Het
Rnpc3 T C 3: 113,616,711 probably null Het
Serpinf2 T C 11: 75,433,239 T321A probably benign Het
Sh3gl1 T C 17: 56,019,119 D129G probably damaging Het
Slc12a2 C A 18: 57,943,996 P1189Q probably damaging Het
Slc16a9 T C 10: 70,282,490 M213T probably benign Het
Svil G A 18: 5,056,854 probably null Het
Synpo A G 18: 60,604,046 L37P probably damaging Het
Tmprss9 A G 10: 80,882,746 H87R probably benign Het
Tmtc1 A T 6: 148,237,855 L885Q probably damaging Het
Ttc41 T C 10: 86,750,264 S811P possibly damaging Het
Vmn2r23 T C 6: 123,712,942 V259A probably benign Het
Wwox T A 8: 114,679,846 H192Q probably benign Het
Other mutations in Fggy
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00835:Fggy APN 4 95837628 missense possibly damaging 0.86
IGL02377:Fggy APN 4 95623477 unclassified probably benign
IGL02417:Fggy APN 4 95849609 missense probably benign 0.01
IGL02527:Fggy APN 4 95697069 missense probably damaging 1.00
IGL02967:Fggy APN 4 95926749 missense possibly damaging 0.74
IGL03053:Fggy APN 4 95926809 unclassified probably benign
IGL03168:Fggy APN 4 95926809 unclassified probably benign
IGL03370:Fggy APN 4 95822064 missense probably damaging 1.00
R0164:Fggy UTSW 4 95837654 missense probably damaging 0.97
R0164:Fggy UTSW 4 95837654 missense probably damaging 0.97
R0312:Fggy UTSW 4 95844185 missense probably damaging 1.00
R0520:Fggy UTSW 4 95601103 missense probably damaging 1.00
R0747:Fggy UTSW 4 95812100 splice site probably benign
R0940:Fggy UTSW 4 95697001 missense probably benign 0.40
R1513:Fggy UTSW 4 95902058 intron probably benign
R1746:Fggy UTSW 4 95926728 missense probably damaging 1.00
R2998:Fggy UTSW 4 95849585 missense probably benign 0.01
R3848:Fggy UTSW 4 95601124 unclassified probably benign
R4913:Fggy UTSW 4 95697076 critical splice donor site probably null
R5458:Fggy UTSW 4 95926743 missense probably benign
R6583:Fggy UTSW 4 95600973 missense probably benign 0.01
R6589:Fggy UTSW 4 95597638 missense probably benign 0.00
R7332:Fggy UTSW 4 95623482 missense probably damaging 0.98
R7359:Fggy UTSW 4 95769480 missense probably benign 0.40
R7453:Fggy UTSW 4 95597690 missense probably damaging 1.00
R7603:Fggy UTSW 4 95769506 missense probably damaging 1.00
R8072:Fggy UTSW 4 95844157 missense possibly damaging 0.75
X0067:Fggy UTSW 4 95696992 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTAGCATTCATTTCCAGGTATATGG -3'
(R):5'- CACAGCTGATATATTCTGAAAACCC -3'

Sequencing Primer
(F):5'- CCAGGTATATGGAGAACCTGTTATC -3'
(R):5'- GCTGATATATTCTGAAAACCCTAGTC -3'
Posted On2017-02-10