Incidental Mutation 'R5868:Vmn2r23'
ID454272
Institutional Source Beutler Lab
Gene Symbol Vmn2r23
Ensembl Gene ENSMUSG00000091620
Gene Namevomeronasal 2, receptor 23
SynonymsEG435916
MMRRC Submission 044076-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R5868 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location123702821-123742291 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 123712942 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 259 (V259A)
Ref Sequence ENSEMBL: ENSMUSP00000126682 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000172391]
Predicted Effect probably benign
Transcript: ENSMUST00000172391
AA Change: V259A

PolyPhen 2 Score 0.115 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000126682
Gene: ENSMUSG00000091620
AA Change: V259A

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:ANF_receptor 79 461 1.7e-31 PFAM
Pfam:NCD3G 513 566 1.2e-23 PFAM
Pfam:7tm_3 596 834 1.5e-55 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.2%
  • 20x: 90.8%
Validation Efficiency 95% (58/61)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810408A11Rik C A 11: 69,897,575 K394N possibly damaging Het
4930451G09Rik T C 16: 4,974,068 noncoding transcript Het
Adamts18 T A 8: 113,777,748 Q80L possibly damaging Het
Apbb2 T A 5: 66,452,096 K69N probably damaging Het
Ascc3 C T 10: 50,842,183 R1991* probably null Het
BC035947 T A 1: 78,498,323 N524I probably damaging Het
Bpifa1 A G 2: 154,143,876 N37S unknown Het
Crnkl1 A T 2: 145,918,553 D648E probably benign Het
Cul5 C A 9: 53,658,673 G86V probably benign Het
Cyfip1 A C 7: 55,926,313 D1077A probably damaging Het
Dennd4a T C 9: 64,896,729 S1117P probably benign Het
Elmo2 A T 2: 165,294,272 M618K possibly damaging Het
Fam205c A T 4: 42,871,711 D221E probably damaging Het
Fggy A G 4: 95,696,988 T35A probably damaging Het
Gad2 G A 2: 22,685,067 probably null Het
Gtf3c2 A C 5: 31,168,081 F455V possibly damaging Het
Hacl1 C A 14: 31,619,916 A311S probably damaging Het
Hist4h4 C T 6: 136,804,294 G29D probably damaging Het
Kat6b G A 14: 21,634,479 D611N probably damaging Het
Kifap3 T C 1: 163,865,472 I611T probably damaging Het
Lrba A G 3: 86,319,604 Y683C probably damaging Het
Maats1 T A 16: 38,332,242 D202V probably damaging Het
Mfsd14a T C 3: 116,633,750 N413S probably benign Het
Mtmr11 T A 3: 96,171,202 D691E possibly damaging Het
Mzf1 A T 7: 13,053,189 F64I probably benign Het
Neu2 G T 1: 87,596,756 Q154H probably damaging Het
Nid1 T C 13: 13,489,157 probably null Het
Nod1 C A 6: 54,939,327 K128N probably damaging Het
Noxred1 T A 12: 87,224,202 Q215L possibly damaging Het
Npat A G 9: 53,570,124 E1044G probably damaging Het
Npr1 A G 3: 90,459,493 probably benign Het
Pdcd6 T C 13: 74,304,014 D169G probably damaging Het
Pld3 G T 7: 27,537,668 T262N probably benign Het
Plxna1 T C 6: 89,322,722 probably benign Het
Prh1 A G 6: 132,572,211 Q227R unknown Het
Prtg C A 9: 72,809,717 Y113* probably null Het
Rbm27 T A 18: 42,300,385 V242E possibly damaging Het
Ripor1 T C 8: 105,616,004 L198P probably damaging Het
Rnpc3 T C 3: 113,616,711 probably null Het
Serpinf2 T C 11: 75,433,239 T321A probably benign Het
Sh3gl1 T C 17: 56,019,119 D129G probably damaging Het
Slc12a2 C A 18: 57,943,996 P1189Q probably damaging Het
Slc16a9 T C 10: 70,282,490 M213T probably benign Het
Svil G A 18: 5,056,854 probably null Het
Synpo A G 18: 60,604,046 L37P probably damaging Het
Tmprss9 A G 10: 80,882,746 H87R probably benign Het
Tmtc1 A T 6: 148,237,855 L885Q probably damaging Het
Ttc41 T C 10: 86,750,264 S811P possibly damaging Het
Wwox T A 8: 114,679,846 H192Q probably benign Het
Other mutations in Vmn2r23
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00324:Vmn2r23 APN 6 123729725 missense possibly damaging 0.89
IGL01012:Vmn2r23 APN 6 123729596 missense probably benign
IGL01073:Vmn2r23 APN 6 123712800 missense possibly damaging 0.82
IGL01547:Vmn2r23 APN 6 123704424 missense possibly damaging 0.88
IGL01571:Vmn2r23 APN 6 123704407 missense probably damaging 1.00
IGL01950:Vmn2r23 APN 6 123741886 missense possibly damaging 0.80
IGL02028:Vmn2r23 APN 6 123741860 missense probably damaging 1.00
IGL02248:Vmn2r23 APN 6 123741744 missense probably damaging 0.96
IGL02318:Vmn2r23 APN 6 123741836 missense probably benign 0.10
IGL02649:Vmn2r23 APN 6 123704478 missense probably benign
IGL02831:Vmn2r23 APN 6 123704385 missense probably benign 0.22
IGL02832:Vmn2r23 APN 6 123704396 missense probably benign 0.00
IGL02865:Vmn2r23 APN 6 123741619 missense probably damaging 1.00
IGL02964:Vmn2r23 APN 6 123741782 missense possibly damaging 0.93
IGL03347:Vmn2r23 APN 6 123704374 missense probably benign 0.01
IGL03396:Vmn2r23 APN 6 123729626 missense probably damaging 1.00
PIT4472001:Vmn2r23 UTSW 6 123712977 missense possibly damaging 0.62
R0597:Vmn2r23 UTSW 6 123729721 missense probably benign 0.08
R0677:Vmn2r23 UTSW 6 123713451 missense probably benign 0.00
R0904:Vmn2r23 UTSW 6 123742135 missense probably damaging 1.00
R1330:Vmn2r23 UTSW 6 123742004 missense probably damaging 1.00
R1424:Vmn2r23 UTSW 6 123713270 nonsense probably null
R1629:Vmn2r23 UTSW 6 123713427 missense probably benign 0.05
R1842:Vmn2r23 UTSW 6 123729690 missense possibly damaging 0.77
R1867:Vmn2r23 UTSW 6 123702915 missense probably damaging 1.00
R1919:Vmn2r23 UTSW 6 123713010 missense possibly damaging 0.94
R2087:Vmn2r23 UTSW 6 123741499 missense probably benign 0.00
R2338:Vmn2r23 UTSW 6 123704425 missense possibly damaging 0.88
R2568:Vmn2r23 UTSW 6 123742188 nonsense probably null
R2867:Vmn2r23 UTSW 6 123713164 missense possibly damaging 0.94
R2867:Vmn2r23 UTSW 6 123713164 missense possibly damaging 0.94
R3500:Vmn2r23 UTSW 6 123713170 missense possibly damaging 0.81
R3789:Vmn2r23 UTSW 6 123741389 missense probably damaging 1.00
R4164:Vmn2r23 UTSW 6 123729738 missense probably benign
R4506:Vmn2r23 UTSW 6 123702925 missense probably damaging 1.00
R4652:Vmn2r23 UTSW 6 123741730 missense probably damaging 1.00
R4697:Vmn2r23 UTSW 6 123741826 missense probably damaging 1.00
R4840:Vmn2r23 UTSW 6 123713074 missense probably damaging 1.00
R4983:Vmn2r23 UTSW 6 123733349 missense probably damaging 1.00
R5276:Vmn2r23 UTSW 6 123712977 missense possibly damaging 0.62
R5392:Vmn2r23 UTSW 6 123704364 missense probably benign 0.36
R5528:Vmn2r23 UTSW 6 123713002 missense probably damaging 1.00
R5529:Vmn2r23 UTSW 6 123713451 missense probably benign 0.00
R5664:Vmn2r23 UTSW 6 123713074 missense probably damaging 1.00
R5749:Vmn2r23 UTSW 6 123733273 missense probably benign
R5761:Vmn2r23 UTSW 6 123712759 missense probably benign 0.39
R5762:Vmn2r23 UTSW 6 123733393 missense probably damaging 1.00
R5935:Vmn2r23 UTSW 6 123741895 missense possibly damaging 0.94
R6242:Vmn2r23 UTSW 6 123704400 missense possibly damaging 0.82
R6416:Vmn2r23 UTSW 6 123712902 missense probably damaging 1.00
R6524:Vmn2r23 UTSW 6 123713425 missense probably damaging 1.00
R6576:Vmn2r23 UTSW 6 123733273 missense probably benign
R6925:Vmn2r23 UTSW 6 123704553 missense probably damaging 1.00
R7148:Vmn2r23 UTSW 6 123713022 missense probably benign
R7215:Vmn2r23 UTSW 6 123704364 missense probably benign 0.36
R7252:Vmn2r23 UTSW 6 123741581 missense probably damaging 0.97
R7403:Vmn2r23 UTSW 6 123704579 missense probably benign 0.01
R8015:Vmn2r23 UTSW 6 123704541 missense not run
RF018:Vmn2r23 UTSW 6 123713116 missense probably benign 0.00
T0975:Vmn2r23 UTSW 6 123713161 missense probably benign 0.00
Z1088:Vmn2r23 UTSW 6 123742108 missense probably damaging 0.98
Z1177:Vmn2r23 UTSW 6 123729725 frame shift probably null
Predicted Primers PCR Primer
(F):5'- AGTTTCCTGTGCACACCAC -3'
(R):5'- TCCTCCACCAAAGTATGTATAACCTAG -3'

Sequencing Primer
(F):5'- ACCACAGCTCTGTATCAGGG -3'
(R):5'- CAGACGTTGTGATCCAGAT -3'
Posted On2017-02-10