Incidental Mutation 'R5868:Prh1'
ID454273
Institutional Source Beutler Lab
Gene Symbol Prh1
Ensembl Gene ENSMUSG00000059934
Gene Nameproline rich protein HaeIII subfamily 1
SynonymsA-type, Prp, MP2
MMRRC Submission 044076-MU
Accession Numbers
Is this an essential gene? Not available question?
Stock #R5868 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location132569809-132572941 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 132572211 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Arginine at position 227 (Q227R)
Ref Sequence ENSEMBL: ENSMUSP00000135877 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074042] [ENSMUST00000111972] [ENSMUST00000177523]
Predicted Effect unknown
Transcript: ENSMUST00000074042
AA Change: Q199R
SMART Domains Protein: ENSMUSP00000073689
Gene: ENSMUSG00000059934
AA Change: Q199R

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
low complexity region 20 44 N/A INTRINSIC
low complexity region 49 244 N/A INTRINSIC
low complexity region 250 261 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000111972
AA Change: Q227R
SMART Domains Protein: ENSMUSP00000107603
Gene: ENSMUSG00000059934
AA Change: Q227R

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
low complexity region 20 44 N/A INTRINSIC
low complexity region 49 272 N/A INTRINSIC
low complexity region 278 289 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000177523
AA Change: Q227R
SMART Domains Protein: ENSMUSP00000135877
Gene: ENSMUSG00000059934
AA Change: Q227R

DomainStartEndE-ValueType
Pfam:Pro-rich 1 88 3.7e-9 PFAM
low complexity region 278 289 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.2%
  • 20x: 90.8%
Validation Efficiency 95% (58/61)
MGI Phenotype FUNCTION: This gene encodes a member of the heterogeneous family of proline-rich salivary glycoproteins. The expression of this gene is dramatically induced in the parotid and submandibular glands of mice by beta-adrenergic stimulation. The encoded protein serves an important dental function by protecting mice against toxic dietary polyphenols such as tannins and influence the visco-elastic properties of the mucus. This gene is located in a cluster of closely related salivary proline-rich proteins on chromosome 6. [provided by RefSeq, Nov 2015]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810408A11Rik C A 11: 69,897,575 K394N possibly damaging Het
4930451G09Rik T C 16: 4,974,068 noncoding transcript Het
Adamts18 T A 8: 113,777,748 Q80L possibly damaging Het
Apbb2 T A 5: 66,452,096 K69N probably damaging Het
Ascc3 C T 10: 50,842,183 R1991* probably null Het
BC035947 T A 1: 78,498,323 N524I probably damaging Het
Bpifa1 A G 2: 154,143,876 N37S unknown Het
Crnkl1 A T 2: 145,918,553 D648E probably benign Het
Cul5 C A 9: 53,658,673 G86V probably benign Het
Cyfip1 A C 7: 55,926,313 D1077A probably damaging Het
Dennd4a T C 9: 64,896,729 S1117P probably benign Het
Elmo2 A T 2: 165,294,272 M618K possibly damaging Het
Fam205c A T 4: 42,871,711 D221E probably damaging Het
Fggy A G 4: 95,696,988 T35A probably damaging Het
Gad2 G A 2: 22,685,067 probably null Het
Gtf3c2 A C 5: 31,168,081 F455V possibly damaging Het
Hacl1 C A 14: 31,619,916 A311S probably damaging Het
Hist4h4 C T 6: 136,804,294 G29D probably damaging Het
Kat6b G A 14: 21,634,479 D611N probably damaging Het
Kifap3 T C 1: 163,865,472 I611T probably damaging Het
Lrba A G 3: 86,319,604 Y683C probably damaging Het
Maats1 T A 16: 38,332,242 D202V probably damaging Het
Mfsd14a T C 3: 116,633,750 N413S probably benign Het
Mtmr11 T A 3: 96,171,202 D691E possibly damaging Het
Mzf1 A T 7: 13,053,189 F64I probably benign Het
Neu2 G T 1: 87,596,756 Q154H probably damaging Het
Nid1 T C 13: 13,489,157 probably null Het
Nod1 C A 6: 54,939,327 K128N probably damaging Het
Noxred1 T A 12: 87,224,202 Q215L possibly damaging Het
Npat A G 9: 53,570,124 E1044G probably damaging Het
Npr1 A G 3: 90,459,493 probably benign Het
Pdcd6 T C 13: 74,304,014 D169G probably damaging Het
Pld3 G T 7: 27,537,668 T262N probably benign Het
Plxna1 T C 6: 89,322,722 probably benign Het
Prtg C A 9: 72,809,717 Y113* probably null Het
Rbm27 T A 18: 42,300,385 V242E possibly damaging Het
Ripor1 T C 8: 105,616,004 L198P probably damaging Het
Rnpc3 T C 3: 113,616,711 probably null Het
Serpinf2 T C 11: 75,433,239 T321A probably benign Het
Sh3gl1 T C 17: 56,019,119 D129G probably damaging Het
Slc12a2 C A 18: 57,943,996 P1189Q probably damaging Het
Slc16a9 T C 10: 70,282,490 M213T probably benign Het
Svil G A 18: 5,056,854 probably null Het
Synpo A G 18: 60,604,046 L37P probably damaging Het
Tmprss9 A G 10: 80,882,746 H87R probably benign Het
Tmtc1 A T 6: 148,237,855 L885Q probably damaging Het
Ttc41 T C 10: 86,750,264 S811P possibly damaging Het
Vmn2r23 T C 6: 123,712,942 V259A probably benign Het
Wwox T A 8: 114,679,846 H192Q probably benign Het
Other mutations in Prh1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02635:Prh1 APN 6 132572283 missense unknown
R0583:Prh1 UTSW 6 132571833 missense unknown
R4434:Prh1 UTSW 6 132571878 missense unknown
R5188:Prh1 UTSW 6 132571707 missense unknown
R6522:Prh1 UTSW 6 132572033 missense unknown
R7293:Prh1 UTSW 6 132571758 missense unknown
Predicted Primers PCR Primer
(F):5'- CTGTTAATGGGAGCCAGCAAG -3'
(R):5'- TTGGTTTACCGAGGTCCCTG -3'

Sequencing Primer
(F):5'- CAGGAGGCCCACAGCATAG -3'
(R):5'- TTACCGAGGTCCCTGGGGTC -3'
Posted On2017-02-10