Incidental Mutation 'R5868:Hist4h4'
ID454274
Institutional Source Beutler Lab
Gene Symbol Hist4h4
Ensembl Gene ENSMUSG00000096010
Gene Namehistone cluster 4, H4
Synonyms
MMRRC Submission 044076-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.943) question?
Stock #R5868 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location136801553-136804415 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 136804294 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 29 (G29D)
Ref Sequence ENSEMBL: ENSMUSP00000136357 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074556] [ENSMUST00000179285] [ENSMUST00000203982]
Predicted Effect probably benign
Transcript: ENSMUST00000074556
SMART Domains Protein: ENSMUSP00000074142
Gene: ENSMUSG00000060032

DomainStartEndE-ValueType
H2A 3 123 2.32e-81 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000179285
AA Change: G29D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000136357
Gene: ENSMUSG00000096010
AA Change: G29D

DomainStartEndE-ValueType
H4 16 90 2.59e-29 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198368
Predicted Effect probably benign
Transcript: ENSMUST00000203982
SMART Domains Protein: ENSMUSP00000144974
Gene: ENSMUSG00000060032

DomainStartEndE-ValueType
H2A 3 123 9.8e-84 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204833
Meta Mutation Damage Score 0.4315 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.2%
  • 20x: 90.8%
Validation Efficiency 95% (58/61)
MGI Phenotype FUNCTION: Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. Nucleosomes consist of approximately 146 bp of DNA wrapped around a histone octamer composed of pairs of each of the four core histones (H2A, H2B, H3, and H4). The chromatin fiber is further compacted through the interaction of a linker histone, H1, with the DNA between the nucleosomes to form higher order chromatin structures. This gene is intronless and encodes a replication-dependent histone that is a member of the histone H4 family. [provided by RefSeq, Aug 2015]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810408A11Rik C A 11: 69,897,575 K394N possibly damaging Het
4930451G09Rik T C 16: 4,974,068 noncoding transcript Het
Adamts18 T A 8: 113,777,748 Q80L possibly damaging Het
Apbb2 T A 5: 66,452,096 K69N probably damaging Het
Ascc3 C T 10: 50,842,183 R1991* probably null Het
BC035947 T A 1: 78,498,323 N524I probably damaging Het
Bpifa1 A G 2: 154,143,876 N37S unknown Het
Crnkl1 A T 2: 145,918,553 D648E probably benign Het
Cul5 C A 9: 53,658,673 G86V probably benign Het
Cyfip1 A C 7: 55,926,313 D1077A probably damaging Het
Dennd4a T C 9: 64,896,729 S1117P probably benign Het
Elmo2 A T 2: 165,294,272 M618K possibly damaging Het
Fam205c A T 4: 42,871,711 D221E probably damaging Het
Fggy A G 4: 95,696,988 T35A probably damaging Het
Gad2 G A 2: 22,685,067 probably null Het
Gtf3c2 A C 5: 31,168,081 F455V possibly damaging Het
Hacl1 C A 14: 31,619,916 A311S probably damaging Het
Kat6b G A 14: 21,634,479 D611N probably damaging Het
Kifap3 T C 1: 163,865,472 I611T probably damaging Het
Lrba A G 3: 86,319,604 Y683C probably damaging Het
Maats1 T A 16: 38,332,242 D202V probably damaging Het
Mfsd14a T C 3: 116,633,750 N413S probably benign Het
Mtmr11 T A 3: 96,171,202 D691E possibly damaging Het
Mzf1 A T 7: 13,053,189 F64I probably benign Het
Neu2 G T 1: 87,596,756 Q154H probably damaging Het
Nid1 T C 13: 13,489,157 probably null Het
Nod1 C A 6: 54,939,327 K128N probably damaging Het
Noxred1 T A 12: 87,224,202 Q215L possibly damaging Het
Npat A G 9: 53,570,124 E1044G probably damaging Het
Npr1 A G 3: 90,459,493 probably benign Het
Pdcd6 T C 13: 74,304,014 D169G probably damaging Het
Pld3 G T 7: 27,537,668 T262N probably benign Het
Plxna1 T C 6: 89,322,722 probably benign Het
Prh1 A G 6: 132,572,211 Q227R unknown Het
Prtg C A 9: 72,809,717 Y113* probably null Het
Rbm27 T A 18: 42,300,385 V242E possibly damaging Het
Ripor1 T C 8: 105,616,004 L198P probably damaging Het
Rnpc3 T C 3: 113,616,711 probably null Het
Serpinf2 T C 11: 75,433,239 T321A probably benign Het
Sh3gl1 T C 17: 56,019,119 D129G probably damaging Het
Slc12a2 C A 18: 57,943,996 P1189Q probably damaging Het
Slc16a9 T C 10: 70,282,490 M213T probably benign Het
Svil G A 18: 5,056,854 probably null Het
Synpo A G 18: 60,604,046 L37P probably damaging Het
Tmprss9 A G 10: 80,882,746 H87R probably benign Het
Tmtc1 A T 6: 148,237,855 L885Q probably damaging Het
Ttc41 T C 10: 86,750,264 S811P possibly damaging Het
Vmn2r23 T C 6: 123,712,942 V259A probably benign Het
Wwox T A 8: 114,679,846 H192Q probably benign Het
Other mutations in Hist4h4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02567:Hist4h4 APN 6 136804274 missense probably damaging 0.97
IGL02625:Hist4h4 APN 6 136804337 unclassified probably benign
R2044:Hist4h4 UTSW 6 136804103 missense possibly damaging 0.73
R2276:Hist4h4 UTSW 6 136804301 missense probably damaging 1.00
R5077:Hist4h4 UTSW 6 136804115 missense probably benign 0.17
R7774:Hist4h4 UTSW 6 136804283 missense possibly damaging 0.93
R8076:Hist4h4 UTSW 6 136804126 missense probably benign 0.15
Predicted Primers PCR Primer
(F):5'- ATAGCCGTAACCGTCTTGCG -3'
(R):5'- TGGTTCTTGGGAGACAGCAG -3'

Sequencing Primer
(F):5'- AACCGTCTTGCGCTTGG -3'
(R):5'- TTCTTGGGAGACAGCAGAGCAC -3'
Posted On2017-02-10