Incidental Mutation 'R5868:Tmtc1'
ID454275
Institutional Source Beutler Lab
Gene Symbol Tmtc1
Ensembl Gene ENSMUSG00000030306
Gene Nametransmembrane and tetratricopeptide repeat containing 1
Synonyms
MMRRC Submission 044076-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.113) question?
Stock #R5868 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location148232430-148444389 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 148237855 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 885 (L885Q)
Ref Sequence ENSEMBL: ENSMUSP00000098335 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060095] [ENSMUST00000100772]
Predicted Effect probably damaging
Transcript: ENSMUST00000060095
AA Change: L923Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000056353
Gene: ENSMUSG00000030306
AA Change: L923Q

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
transmembrane domain 111 130 N/A INTRINSIC
transmembrane domain 142 164 N/A INTRINSIC
low complexity region 170 180 N/A INTRINSIC
transmembrane domain 195 217 N/A INTRINSIC
low complexity region 250 269 N/A INTRINSIC
transmembrane domain 328 350 N/A INTRINSIC
Pfam:DUF1736 351 425 1.3e-33 PFAM
transmembrane domain 444 466 N/A INTRINSIC
transmembrane domain 494 516 N/A INTRINSIC
TPR 543 576 2.42e-3 SMART
TPR 577 607 8.76e-1 SMART
TPR 608 641 1.69e-2 SMART
TPR 642 675 1.28e-2 SMART
TPR 676 709 4.31e0 SMART
TPR 710 743 1.11e-2 SMART
TPR 744 776 4.62e0 SMART
TPR 811 844 1.1e-1 SMART
TPR 849 882 4.45e-2 SMART
TPR 883 916 1.05e-3 SMART
low complexity region 926 941 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000100772
AA Change: L885Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000098335
Gene: ENSMUSG00000030306
AA Change: L885Q

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
transmembrane domain 111 130 N/A INTRINSIC
transmembrane domain 142 164 N/A INTRINSIC
low complexity region 170 180 N/A INTRINSIC
transmembrane domain 195 217 N/A INTRINSIC
low complexity region 250 269 N/A INTRINSIC
Pfam:DUF1736 349 427 6.9e-35 PFAM
transmembrane domain 444 466 N/A INTRINSIC
transmembrane domain 494 516 N/A INTRINSIC
TPR 539 569 8.76e-1 SMART
TPR 570 603 1.69e-2 SMART
TPR 604 637 1.28e-2 SMART
TPR 638 671 4.31e0 SMART
TPR 672 705 1.11e-2 SMART
TPR 706 738 4.62e0 SMART
TPR 773 806 1.1e-1 SMART
TPR 811 844 4.45e-2 SMART
TPR 845 878 1.05e-3 SMART
low complexity region 888 903 N/A INTRINSIC
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.2%
  • 20x: 90.8%
Validation Efficiency 95% (58/61)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810408A11Rik C A 11: 69,897,575 K394N possibly damaging Het
4930451G09Rik T C 16: 4,974,068 noncoding transcript Het
Adamts18 T A 8: 113,777,748 Q80L possibly damaging Het
Apbb2 T A 5: 66,452,096 K69N probably damaging Het
Ascc3 C T 10: 50,842,183 R1991* probably null Het
BC035947 T A 1: 78,498,323 N524I probably damaging Het
Bpifa1 A G 2: 154,143,876 N37S unknown Het
Crnkl1 A T 2: 145,918,553 D648E probably benign Het
Cul5 C A 9: 53,658,673 G86V probably benign Het
Cyfip1 A C 7: 55,926,313 D1077A probably damaging Het
Dennd4a T C 9: 64,896,729 S1117P probably benign Het
Elmo2 A T 2: 165,294,272 M618K possibly damaging Het
Fam205c A T 4: 42,871,711 D221E probably damaging Het
Fggy A G 4: 95,696,988 T35A probably damaging Het
Gad2 G A 2: 22,685,067 probably null Het
Gtf3c2 A C 5: 31,168,081 F455V possibly damaging Het
Hacl1 C A 14: 31,619,916 A311S probably damaging Het
Hist4h4 C T 6: 136,804,294 G29D probably damaging Het
Kat6b G A 14: 21,634,479 D611N probably damaging Het
Kifap3 T C 1: 163,865,472 I611T probably damaging Het
Lrba A G 3: 86,319,604 Y683C probably damaging Het
Maats1 T A 16: 38,332,242 D202V probably damaging Het
Mfsd14a T C 3: 116,633,750 N413S probably benign Het
Mtmr11 T A 3: 96,171,202 D691E possibly damaging Het
Mzf1 A T 7: 13,053,189 F64I probably benign Het
Neu2 G T 1: 87,596,756 Q154H probably damaging Het
Nid1 T C 13: 13,489,157 probably null Het
Nod1 C A 6: 54,939,327 K128N probably damaging Het
Noxred1 T A 12: 87,224,202 Q215L possibly damaging Het
Npat A G 9: 53,570,124 E1044G probably damaging Het
Npr1 A G 3: 90,459,493 probably benign Het
Pdcd6 T C 13: 74,304,014 D169G probably damaging Het
Pld3 G T 7: 27,537,668 T262N probably benign Het
Plxna1 T C 6: 89,322,722 probably benign Het
Prh1 A G 6: 132,572,211 Q227R unknown Het
Prtg C A 9: 72,809,717 Y113* probably null Het
Rbm27 T A 18: 42,300,385 V242E possibly damaging Het
Ripor1 T C 8: 105,616,004 L198P probably damaging Het
Rnpc3 T C 3: 113,616,711 probably null Het
Serpinf2 T C 11: 75,433,239 T321A probably benign Het
Sh3gl1 T C 17: 56,019,119 D129G probably damaging Het
Slc12a2 C A 18: 57,943,996 P1189Q probably damaging Het
Slc16a9 T C 10: 70,282,490 M213T probably benign Het
Svil G A 18: 5,056,854 probably null Het
Synpo A G 18: 60,604,046 L37P probably damaging Het
Tmprss9 A G 10: 80,882,746 H87R probably benign Het
Ttc41 T C 10: 86,750,264 S811P possibly damaging Het
Vmn2r23 T C 6: 123,712,942 V259A probably benign Het
Wwox T A 8: 114,679,846 H192Q probably benign Het
Other mutations in Tmtc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:Tmtc1 APN 6 148443944 missense probably benign 0.02
IGL01377:Tmtc1 APN 6 148245787 missense possibly damaging 0.82
IGL01728:Tmtc1 APN 6 148411066 missense probably benign 0.02
IGL02904:Tmtc1 APN 6 148249482 splice site probably benign
R0044:Tmtc1 UTSW 6 148412829 splice site probably benign
R0107:Tmtc1 UTSW 6 148425913 missense possibly damaging 0.85
R0114:Tmtc1 UTSW 6 148412830 splice site probably benign
R0243:Tmtc1 UTSW 6 148246837 missense probably damaging 1.00
R0310:Tmtc1 UTSW 6 148249581 missense probably benign 0.00
R0441:Tmtc1 UTSW 6 148415758 missense probably damaging 1.00
R0491:Tmtc1 UTSW 6 148412640 critical splice donor site probably null
R0578:Tmtc1 UTSW 6 148355218 intron probably benign
R0685:Tmtc1 UTSW 6 148411240 missense probably benign 0.39
R1470:Tmtc1 UTSW 6 148305985 splice site probably benign
R1533:Tmtc1 UTSW 6 148245710 critical splice donor site probably null
R1577:Tmtc1 UTSW 6 148412820 critical splice acceptor site probably null
R1617:Tmtc1 UTSW 6 148355404 intron probably benign
R1763:Tmtc1 UTSW 6 148294618 missense probably damaging 1.00
R1909:Tmtc1 UTSW 6 148444048 missense possibly damaging 0.93
R1943:Tmtc1 UTSW 6 148425918 nonsense probably null
R2050:Tmtc1 UTSW 6 148262883 missense probably damaging 1.00
R2305:Tmtc1 UTSW 6 148244697 missense probably damaging 0.99
R3813:Tmtc1 UTSW 6 148354891 intron probably benign
R4355:Tmtc1 UTSW 6 148355098 intron probably benign
R4537:Tmtc1 UTSW 6 148262782 critical splice donor site probably null
R4731:Tmtc1 UTSW 6 148284980 splice site probably null
R4732:Tmtc1 UTSW 6 148284980 splice site probably null
R4733:Tmtc1 UTSW 6 148284980 splice site probably null
R4960:Tmtc1 UTSW 6 148443947 unclassified probably benign
R5048:Tmtc1 UTSW 6 148237846 missense possibly damaging 0.96
R5118:Tmtc1 UTSW 6 148269987 intron probably benign
R5279:Tmtc1 UTSW 6 148355131 intron probably benign
R5310:Tmtc1 UTSW 6 148355412 intron probably benign
R5411:Tmtc1 UTSW 6 148443899 critical splice donor site probably null
R5646:Tmtc1 UTSW 6 148246831 missense probably damaging 1.00
R6482:Tmtc1 UTSW 6 148412745 missense probably benign 0.00
R7162:Tmtc1 UTSW 6 148271487 missense probably damaging 1.00
R7462:Tmtc1 UTSW 6 148325145 missense probably damaging 1.00
R7702:Tmtc1 UTSW 6 148443917 missense probably benign 0.35
RF018:Tmtc1 UTSW 6 148247511 missense probably damaging 1.00
Z1177:Tmtc1 UTSW 6 148411080 missense possibly damaging 0.61
Predicted Primers PCR Primer
(F):5'- GCTGTTTGTCTCTTCATGGAAAC -3'
(R):5'- TGATCACTGGCAGTCAGAGG -3'

Sequencing Primer
(F):5'- AGTGACTGACTCCCACTGTG -3'
(R):5'- TCACTGGCAGTCAGAGGAAAGG -3'
Posted On2017-02-10