Incidental Mutation 'R5868:Mzf1'
ID454276
Institutional Source Beutler Lab
Gene Symbol Mzf1
Ensembl Gene ENSMUSG00000030380
Gene Namemyeloid zinc finger 1
SynonymsZnf42, Zfp121, Zfp98, Mzf2
MMRRC Submission 044076-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.183) question?
Stock #R5868 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location13042303-13054764 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 13053189 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 64 (F64I)
Ref Sequence ENSEMBL: ENSMUSP00000138271 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069289] [ENSMUST00000182087] [ENSMUST00000182490] [ENSMUST00000182515]
Predicted Effect probably benign
Transcript: ENSMUST00000069289
SMART Domains Protein: ENSMUSP00000069122
Gene: ENSMUSG00000030380

DomainStartEndE-ValueType
low complexity region 24 34 N/A INTRINSIC
SCAN 41 153 1.18e-70 SMART
ZnF_C2H2 357 379 4.87e-4 SMART
ZnF_C2H2 385 407 1.95e-3 SMART
ZnF_C2H2 413 435 1.18e-2 SMART
ZnF_C2H2 441 463 8.6e-5 SMART
ZnF_C2H2 486 508 1.79e-2 SMART
ZnF_C2H2 514 536 7.15e-2 SMART
ZnF_C2H2 542 564 8.47e-4 SMART
ZnF_C2H2 570 592 2.79e-4 SMART
ZnF_C2H2 598 620 1.6e-4 SMART
ZnF_C2H2 626 648 1.67e-2 SMART
ZnF_C2H2 654 676 3.44e-4 SMART
ZnF_C2H2 682 704 2.84e-5 SMART
ZnF_C2H2 710 732 2.4e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000182087
SMART Domains Protein: ENSMUSP00000138163
Gene: ENSMUSG00000030380

DomainStartEndE-ValueType
low complexity region 24 34 N/A INTRINSIC
SCAN 41 152 9.06e-58 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182293
Predicted Effect probably benign
Transcript: ENSMUST00000182490
AA Change: F64I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000138271
Gene: ENSMUSG00000030380
AA Change: F64I

DomainStartEndE-ValueType
low complexity region 103 113 N/A INTRINSIC
SCAN 120 232 1.18e-70 SMART
ZnF_C2H2 436 458 4.87e-4 SMART
ZnF_C2H2 464 486 1.95e-3 SMART
ZnF_C2H2 492 514 1.18e-2 SMART
ZnF_C2H2 520 542 8.6e-5 SMART
ZnF_C2H2 565 587 1.79e-2 SMART
ZnF_C2H2 593 615 7.15e-2 SMART
ZnF_C2H2 621 643 8.47e-4 SMART
ZnF_C2H2 649 671 2.79e-4 SMART
ZnF_C2H2 677 699 1.6e-4 SMART
ZnF_C2H2 705 727 1.67e-2 SMART
ZnF_C2H2 733 755 3.44e-4 SMART
ZnF_C2H2 761 783 2.84e-5 SMART
ZnF_C2H2 789 811 2.4e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000182515
SMART Domains Protein: ENSMUSP00000138387
Gene: ENSMUSG00000030380

DomainStartEndE-ValueType
low complexity region 24 34 N/A INTRINSIC
SCAN 41 153 1.18e-70 SMART
ZnF_C2H2 357 379 4.87e-4 SMART
ZnF_C2H2 385 407 1.95e-3 SMART
ZnF_C2H2 413 435 1.18e-2 SMART
ZnF_C2H2 441 463 8.6e-5 SMART
ZnF_C2H2 486 508 1.79e-2 SMART
ZnF_C2H2 514 536 7.15e-2 SMART
ZnF_C2H2 542 564 8.47e-4 SMART
ZnF_C2H2 570 592 2.79e-4 SMART
ZnF_C2H2 598 620 1.6e-4 SMART
ZnF_C2H2 626 648 1.67e-2 SMART
ZnF_C2H2 654 676 3.44e-4 SMART
ZnF_C2H2 682 704 2.84e-5 SMART
ZnF_C2H2 710 732 2.4e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183176
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210727
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.2%
  • 20x: 90.8%
Validation Efficiency 95% (58/61)
MGI Phenotype PHENOTYPE: Homozygous mutants are prone to late-onset (>2 yr) neoplasias characterized by infiltration, enlargement and disruption of the liver by monomorphic cells of myeloid origin; hemopoietic progenitors show increased ability to sustain long-term hemopoiesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810408A11Rik C A 11: 69,897,575 K394N possibly damaging Het
4930451G09Rik T C 16: 4,974,068 noncoding transcript Het
Adamts18 T A 8: 113,777,748 Q80L possibly damaging Het
Apbb2 T A 5: 66,452,096 K69N probably damaging Het
Ascc3 C T 10: 50,842,183 R1991* probably null Het
BC035947 T A 1: 78,498,323 N524I probably damaging Het
Bpifa1 A G 2: 154,143,876 N37S unknown Het
Crnkl1 A T 2: 145,918,553 D648E probably benign Het
Cul5 C A 9: 53,658,673 G86V probably benign Het
Cyfip1 A C 7: 55,926,313 D1077A probably damaging Het
Dennd4a T C 9: 64,896,729 S1117P probably benign Het
Elmo2 A T 2: 165,294,272 M618K possibly damaging Het
Fam205c A T 4: 42,871,711 D221E probably damaging Het
Fggy A G 4: 95,696,988 T35A probably damaging Het
Gad2 G A 2: 22,685,067 probably null Het
Gtf3c2 A C 5: 31,168,081 F455V possibly damaging Het
Hacl1 C A 14: 31,619,916 A311S probably damaging Het
Hist4h4 C T 6: 136,804,294 G29D probably damaging Het
Kat6b G A 14: 21,634,479 D611N probably damaging Het
Kifap3 T C 1: 163,865,472 I611T probably damaging Het
Lrba A G 3: 86,319,604 Y683C probably damaging Het
Maats1 T A 16: 38,332,242 D202V probably damaging Het
Mfsd14a T C 3: 116,633,750 N413S probably benign Het
Mtmr11 T A 3: 96,171,202 D691E possibly damaging Het
Neu2 G T 1: 87,596,756 Q154H probably damaging Het
Nid1 T C 13: 13,489,157 probably null Het
Nod1 C A 6: 54,939,327 K128N probably damaging Het
Noxred1 T A 12: 87,224,202 Q215L possibly damaging Het
Npat A G 9: 53,570,124 E1044G probably damaging Het
Npr1 A G 3: 90,459,493 probably benign Het
Pdcd6 T C 13: 74,304,014 D169G probably damaging Het
Pld3 G T 7: 27,537,668 T262N probably benign Het
Plxna1 T C 6: 89,322,722 probably benign Het
Prh1 A G 6: 132,572,211 Q227R unknown Het
Prtg C A 9: 72,809,717 Y113* probably null Het
Rbm27 T A 18: 42,300,385 V242E possibly damaging Het
Ripor1 T C 8: 105,616,004 L198P probably damaging Het
Rnpc3 T C 3: 113,616,711 probably null Het
Serpinf2 T C 11: 75,433,239 T321A probably benign Het
Sh3gl1 T C 17: 56,019,119 D129G probably damaging Het
Slc12a2 C A 18: 57,943,996 P1189Q probably damaging Het
Slc16a9 T C 10: 70,282,490 M213T probably benign Het
Svil G A 18: 5,056,854 probably null Het
Synpo A G 18: 60,604,046 L37P probably damaging Het
Tmprss9 A G 10: 80,882,746 H87R probably benign Het
Tmtc1 A T 6: 148,237,855 L885Q probably damaging Het
Ttc41 T C 10: 86,750,264 S811P possibly damaging Het
Vmn2r23 T C 6: 123,712,942 V259A probably benign Het
Wwox T A 8: 114,679,846 H192Q probably benign Het
Other mutations in Mzf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00418:Mzf1 APN 7 13044616 missense possibly damaging 0.85
IGL01728:Mzf1 APN 7 13051727 splice site probably benign
IGL02194:Mzf1 APN 7 13043720 missense possibly damaging 0.53
IGL02256:Mzf1 APN 7 13052737 splice site probably benign
IGL02584:Mzf1 APN 7 13052817 missense probably damaging 0.98
IGL02678:Mzf1 APN 7 13052909 missense probably benign 0.00
R0903:Mzf1 UTSW 7 13052771 missense possibly damaging 0.82
R0904:Mzf1 UTSW 7 13052771 missense possibly damaging 0.82
R0905:Mzf1 UTSW 7 13052771 missense possibly damaging 0.82
R1128:Mzf1 UTSW 7 13052771 missense possibly damaging 0.82
R1131:Mzf1 UTSW 7 13052771 missense possibly damaging 0.82
R1280:Mzf1 UTSW 7 13053083 missense probably damaging 0.96
R1400:Mzf1 UTSW 7 13052771 missense possibly damaging 0.82
R1640:Mzf1 UTSW 7 13043270 makesense probably null
R1687:Mzf1 UTSW 7 13052771 missense possibly damaging 0.82
R4014:Mzf1 UTSW 7 13043956 missense possibly damaging 0.47
R4721:Mzf1 UTSW 7 13043296 missense possibly damaging 0.52
R4721:Mzf1 UTSW 7 13043521 missense possibly damaging 0.53
R5511:Mzf1 UTSW 7 13051599 missense possibly damaging 0.95
R5611:Mzf1 UTSW 7 13044627 utr 3 prime probably benign
R5728:Mzf1 UTSW 7 13044058 missense probably benign 0.00
R6283:Mzf1 UTSW 7 13053369 intron probably benign
R7059:Mzf1 UTSW 7 13053058 missense probably damaging 0.96
R7066:Mzf1 UTSW 7 13043563 missense possibly damaging 0.92
R7763:Mzf1 UTSW 7 13044091 missense probably damaging 1.00
R8157:Mzf1 UTSW 7 13044352 missense probably damaging 1.00
R8870:Mzf1 UTSW 7 13052909 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTTCCTGAGGACCTATTGCATC -3'
(R):5'- GGCTCATATAGAGTTCCCACG -3'

Sequencing Primer
(F):5'- TATTGCATCCTCATACCGGAAG -3'
(R):5'- CATATAGAGTTCCCACGGATCTC -3'
Posted On2017-02-10