Incidental Mutation 'R5868:Wwox'
ID454281
Institutional Source Beutler Lab
Gene Symbol Wwox
Ensembl Gene ENSMUSG00000004637
Gene NameWW domain-containing oxidoreductase
Synonyms9030416C10Rik, WOX1, 5330426P09Rik
MMRRC Submission 044076-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.865) question?
Stock #R5868 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location114439655-115352708 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 114679846 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 192 (H192Q)
Ref Sequence ENSEMBL: ENSMUSP00000125626 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004756] [ENSMUST00000109108] [ENSMUST00000160862]
Predicted Effect probably benign
Transcript: ENSMUST00000004756
AA Change: H192Q

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000004756
Gene: ENSMUSG00000004637
AA Change: H192Q

DomainStartEndE-ValueType
WW 17 49 3.31e-9 SMART
WW 58 90 5.76e-9 SMART
Pfam:KR 125 267 3e-9 PFAM
Pfam:adh_short 125 269 2.2e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109108
AA Change: H192Q

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000104736
Gene: ENSMUSG00000004637
AA Change: H192Q

DomainStartEndE-ValueType
WW 17 49 3.31e-9 SMART
WW 58 90 5.76e-9 SMART
Pfam:KR 125 267 1.4e-9 PFAM
Pfam:adh_short 125 270 4e-20 PFAM
Pfam:adh_short_C2 131 268 2.4e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160205
Predicted Effect probably benign
Transcript: ENSMUST00000160862
AA Change: H192Q

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000125626
Gene: ENSMUSG00000004637
AA Change: H192Q

DomainStartEndE-ValueType
WW 17 49 3.31e-9 SMART
WW 58 90 5.76e-9 SMART
Pfam:KR 125 267 1.3e-9 PFAM
Pfam:adh_short 125 270 3.7e-20 PFAM
Pfam:adh_short_C2 131 268 2.3e-8 PFAM
Meta Mutation Damage Score 0.0585 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.2%
  • 20x: 90.8%
Validation Efficiency 95% (58/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the short-chain dehydrogenases/reductases (SDR) protein family. This gene spans the FRA16D common chromosomal fragile site and appears to function as a tumor suppressor gene. Expression of the encoded protein is able to induce apoptosis, while defects in this gene are associated with multiple types of cancer. Disruption of this gene is also associated with autosomal recessive spinocerebellar ataxia 12. Disruption of a similar gene in mouse results in impaired steroidogenesis, additionally suggesting a metabolic function for the protein. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2014]
PHENOTYPE: Homozygous mutation of this gene results in premature death and increased incidence of tumor development. Reduced male fertility and testicular atrophy are also observed in mice with a hypomorphic allele. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810408A11Rik C A 11: 69,897,575 K394N possibly damaging Het
4930451G09Rik T C 16: 4,974,068 noncoding transcript Het
Adamts18 T A 8: 113,777,748 Q80L possibly damaging Het
Apbb2 T A 5: 66,452,096 K69N probably damaging Het
Ascc3 C T 10: 50,842,183 R1991* probably null Het
BC035947 T A 1: 78,498,323 N524I probably damaging Het
Bpifa1 A G 2: 154,143,876 N37S unknown Het
Crnkl1 A T 2: 145,918,553 D648E probably benign Het
Cul5 C A 9: 53,658,673 G86V probably benign Het
Cyfip1 A C 7: 55,926,313 D1077A probably damaging Het
Dennd4a T C 9: 64,896,729 S1117P probably benign Het
Elmo2 A T 2: 165,294,272 M618K possibly damaging Het
Fam205c A T 4: 42,871,711 D221E probably damaging Het
Fggy A G 4: 95,696,988 T35A probably damaging Het
Gad2 G A 2: 22,685,067 probably null Het
Gtf3c2 A C 5: 31,168,081 F455V possibly damaging Het
Hacl1 C A 14: 31,619,916 A311S probably damaging Het
Hist4h4 C T 6: 136,804,294 G29D probably damaging Het
Kat6b G A 14: 21,634,479 D611N probably damaging Het
Kifap3 T C 1: 163,865,472 I611T probably damaging Het
Lrba A G 3: 86,319,604 Y683C probably damaging Het
Maats1 T A 16: 38,332,242 D202V probably damaging Het
Mfsd14a T C 3: 116,633,750 N413S probably benign Het
Mtmr11 T A 3: 96,171,202 D691E possibly damaging Het
Mzf1 A T 7: 13,053,189 F64I probably benign Het
Neu2 G T 1: 87,596,756 Q154H probably damaging Het
Nid1 T C 13: 13,489,157 probably null Het
Nod1 C A 6: 54,939,327 K128N probably damaging Het
Noxred1 T A 12: 87,224,202 Q215L possibly damaging Het
Npat A G 9: 53,570,124 E1044G probably damaging Het
Npr1 A G 3: 90,459,493 probably benign Het
Pdcd6 T C 13: 74,304,014 D169G probably damaging Het
Pld3 G T 7: 27,537,668 T262N probably benign Het
Plxna1 T C 6: 89,322,722 probably benign Het
Prh1 A G 6: 132,572,211 Q227R unknown Het
Prtg C A 9: 72,809,717 Y113* probably null Het
Rbm27 T A 18: 42,300,385 V242E possibly damaging Het
Ripor1 T C 8: 105,616,004 L198P probably damaging Het
Rnpc3 T C 3: 113,616,711 probably null Het
Serpinf2 T C 11: 75,433,239 T321A probably benign Het
Sh3gl1 T C 17: 56,019,119 D129G probably damaging Het
Slc12a2 C A 18: 57,943,996 P1189Q probably damaging Het
Slc16a9 T C 10: 70,282,490 M213T probably benign Het
Svil G A 18: 5,056,854 probably null Het
Synpo A G 18: 60,604,046 L37P probably damaging Het
Tmprss9 A G 10: 80,882,746 H87R probably benign Het
Tmtc1 A T 6: 148,237,855 L885Q probably damaging Het
Ttc41 T C 10: 86,750,264 S811P possibly damaging Het
Vmn2r23 T C 6: 123,712,942 V259A probably benign Het
Other mutations in Wwox
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01098:Wwox APN 8 114445378 nonsense probably null
IGL02156:Wwox APN 8 114448159 critical splice acceptor site probably null
IGL02267:Wwox APN 8 114712065 missense probably benign 0.23
IGL02346:Wwox APN 8 114712118 missense probably benign 0.11
IGL02350:Wwox APN 8 114712142 missense possibly damaging 0.81
IGL02357:Wwox APN 8 114712142 missense possibly damaging 0.81
IGL02586:Wwox APN 8 114712207 missense possibly damaging 0.59
IGL02701:Wwox APN 8 114706368 missense probably damaging 1.00
IGL02743:Wwox APN 8 115351704 missense probably damaging 1.00
IGL02804:Wwox APN 8 114712013 missense probably damaging 1.00
IGL02805:Wwox APN 8 114712013 missense probably damaging 1.00
R0048:Wwox UTSW 8 114439830 missense probably damaging 1.00
R0140:Wwox UTSW 8 114706287 missense probably damaging 1.00
R0390:Wwox UTSW 8 114706278 missense probably benign 0.08
R1146:Wwox UTSW 8 114712036 missense probably damaging 1.00
R1146:Wwox UTSW 8 114712036 missense probably damaging 1.00
R1193:Wwox UTSW 8 114679874 missense probably benign
R1520:Wwox UTSW 8 114712133 missense probably benign 0.36
R1552:Wwox UTSW 8 114445350 nonsense probably null
R1628:Wwox UTSW 8 114448233 missense probably benign
R1639:Wwox UTSW 8 114445378 nonsense probably null
R3778:Wwox UTSW 8 114874607 missense probably benign 0.00
R3967:Wwox UTSW 8 114488933 missense probably damaging 1.00
R4077:Wwox UTSW 8 114439741 utr 5 prime probably benign
R4876:Wwox UTSW 8 114448248 missense probably damaging 1.00
R4936:Wwox UTSW 8 114706358 missense probably benign 0.00
R5988:Wwox UTSW 8 114706341 missense probably benign 0.06
R6272:Wwox UTSW 8 114488952 missense probably damaging 1.00
R7043:Wwox UTSW 8 114679838 missense probably damaging 0.97
R7348:Wwox UTSW 8 114472652 missense probably benign 0.00
R7815:Wwox UTSW 8 114712036 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTGGGCTTCTAATATTAAACAGGG -3'
(R):5'- AAACTGCCCTGGTGTGCATC -3'

Sequencing Primer
(F):5'- GGGGAATTCCGACATGTTCCATAAC -3'
(R):5'- CACATCTCATGAGGAGGGTGACTC -3'
Posted On2017-02-10