Incidental Mutation 'R5868:Tmprss9'
ID454288
Institutional Source Beutler Lab
Gene Symbol Tmprss9
Ensembl Gene ENSMUSG00000059406
Gene Nametransmembrane protease, serine 9
SynonymsSerase-1B
MMRRC Submission 044076-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.093) question?
Stock #R5868 (G1)
Quality Score104
Status Validated
Chromosome10
Chromosomal Location80871848-80899492 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 80882746 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 87 (H87R)
Ref Sequence ENSEMBL: ENSMUSP00000152034 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105333] [ENSMUST00000219817]
Predicted Effect probably benign
Transcript: ENSMUST00000105333
AA Change: H87R

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000100970
Gene: ENSMUSG00000059406
AA Change: H87R

DomainStartEndE-ValueType
Pfam:SEA 62 155 1.7e-10 PFAM
LDLa 189 227 1.15e-4 SMART
Tryp_SPc 238 467 2.43e-96 SMART
low complexity region 477 502 N/A INTRINSIC
Tryp_SPc 539 767 7.28e-86 SMART
Tryp_SPc 867 1093 1.62e-92 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219742
Predicted Effect probably benign
Transcript: ENSMUST00000219817
AA Change: H87R

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.2%
  • 20x: 90.8%
Validation Efficiency 95% (58/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a membrane-bound type II serine polyprotease that is cleaved to release three different proteases. Two of the proteases are active and can be inhibited by serine protease inhibitors, and one is thought to be catalytically inactive. This gene enhances the invasive capability of pancreatic cancer cells and may be involved in cancer progression. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810408A11Rik C A 11: 69,897,575 K394N possibly damaging Het
4930451G09Rik T C 16: 4,974,068 noncoding transcript Het
Adamts18 T A 8: 113,777,748 Q80L possibly damaging Het
Apbb2 T A 5: 66,452,096 K69N probably damaging Het
Ascc3 C T 10: 50,842,183 R1991* probably null Het
BC035947 T A 1: 78,498,323 N524I probably damaging Het
Bpifa1 A G 2: 154,143,876 N37S unknown Het
Crnkl1 A T 2: 145,918,553 D648E probably benign Het
Cul5 C A 9: 53,658,673 G86V probably benign Het
Cyfip1 A C 7: 55,926,313 D1077A probably damaging Het
Dennd4a T C 9: 64,896,729 S1117P probably benign Het
Elmo2 A T 2: 165,294,272 M618K possibly damaging Het
Fam205c A T 4: 42,871,711 D221E probably damaging Het
Fggy A G 4: 95,696,988 T35A probably damaging Het
Gad2 G A 2: 22,685,067 probably null Het
Gtf3c2 A C 5: 31,168,081 F455V possibly damaging Het
Hacl1 C A 14: 31,619,916 A311S probably damaging Het
Hist4h4 C T 6: 136,804,294 G29D probably damaging Het
Kat6b G A 14: 21,634,479 D611N probably damaging Het
Kifap3 T C 1: 163,865,472 I611T probably damaging Het
Lrba A G 3: 86,319,604 Y683C probably damaging Het
Maats1 T A 16: 38,332,242 D202V probably damaging Het
Mfsd14a T C 3: 116,633,750 N413S probably benign Het
Mtmr11 T A 3: 96,171,202 D691E possibly damaging Het
Mzf1 A T 7: 13,053,189 F64I probably benign Het
Neu2 G T 1: 87,596,756 Q154H probably damaging Het
Nid1 T C 13: 13,489,157 probably null Het
Nod1 C A 6: 54,939,327 K128N probably damaging Het
Noxred1 T A 12: 87,224,202 Q215L possibly damaging Het
Npat A G 9: 53,570,124 E1044G probably damaging Het
Npr1 A G 3: 90,459,493 probably benign Het
Pdcd6 T C 13: 74,304,014 D169G probably damaging Het
Pld3 G T 7: 27,537,668 T262N probably benign Het
Plxna1 T C 6: 89,322,722 probably benign Het
Prh1 A G 6: 132,572,211 Q227R unknown Het
Prtg C A 9: 72,809,717 Y113* probably null Het
Rbm27 T A 18: 42,300,385 V242E possibly damaging Het
Ripor1 T C 8: 105,616,004 L198P probably damaging Het
Rnpc3 T C 3: 113,616,711 probably null Het
Serpinf2 T C 11: 75,433,239 T321A probably benign Het
Sh3gl1 T C 17: 56,019,119 D129G probably damaging Het
Slc12a2 C A 18: 57,943,996 P1189Q probably damaging Het
Slc16a9 T C 10: 70,282,490 M213T probably benign Het
Svil G A 18: 5,056,854 probably null Het
Synpo A G 18: 60,604,046 L37P probably damaging Het
Tmtc1 A T 6: 148,237,855 L885Q probably damaging Het
Ttc41 T C 10: 86,750,264 S811P possibly damaging Het
Vmn2r23 T C 6: 123,712,942 V259A probably benign Het
Wwox T A 8: 114,679,846 H192Q probably benign Het
Other mutations in Tmprss9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00482:Tmprss9 APN 10 80894428 critical splice donor site probably null
IGL00990:Tmprss9 APN 10 80892292 missense possibly damaging 0.92
IGL01710:Tmprss9 APN 10 80897959 unclassified probably benign
IGL03075:Tmprss9 APN 10 80884029 missense possibly damaging 0.77
IGL03132:Tmprss9 APN 10 80894865 missense probably damaging 0.98
R0142:Tmprss9 UTSW 10 80894378 missense possibly damaging 0.92
R0546:Tmprss9 UTSW 10 80899323 missense probably benign 0.00
R1171:Tmprss9 UTSW 10 80879858 missense possibly damaging 0.92
R1296:Tmprss9 UTSW 10 80890445 missense probably benign 0.02
R1302:Tmprss9 UTSW 10 80895129 missense probably benign 0.00
R1498:Tmprss9 UTSW 10 80895100 missense probably benign 0.01
R1706:Tmprss9 UTSW 10 80898187 unclassified probably benign
R1851:Tmprss9 UTSW 10 80892285 missense probably damaging 0.98
R2096:Tmprss9 UTSW 10 80889434 missense probably damaging 1.00
R2198:Tmprss9 UTSW 10 80887459 missense probably damaging 1.00
R3783:Tmprss9 UTSW 10 80887467 missense probably damaging 1.00
R5682:Tmprss9 UTSW 10 80897373 splice site probably null
R6006:Tmprss9 UTSW 10 80883721 missense possibly damaging 0.92
R6542:Tmprss9 UTSW 10 80888555 missense probably damaging 1.00
R6676:Tmprss9 UTSW 10 80898311 unclassified probably benign
R6718:Tmprss9 UTSW 10 80890364 missense probably benign
R7062:Tmprss9 UTSW 10 80895049 missense probably benign 0.00
R7316:Tmprss9 UTSW 10 80894979 missense probably benign 0.00
R7337:Tmprss9 UTSW 10 80882670 missense probably benign 0.00
R7624:Tmprss9 UTSW 10 80892219 missense possibly damaging 0.77
R7659:Tmprss9 UTSW 10 80893009 missense probably damaging 0.97
R7810:Tmprss9 UTSW 10 80897311 missense unknown
X0062:Tmprss9 UTSW 10 80883938 splice site probably null
X0066:Tmprss9 UTSW 10 80893230 missense probably damaging 0.99
Z1176:Tmprss9 UTSW 10 80888422 missense probably damaging 0.98
Z1177:Tmprss9 UTSW 10 80887522 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGACTCAATGCTGCTCCACC -3'
(R):5'- GGACATTGTGCTCAGTAAGAAACC -3'

Sequencing Primer
(F):5'- AATGCTGCTCCACCTGGGG -3'
(R):5'- TTGTGCTCAGTAAGAAACCAACACAG -3'
Posted On2017-02-10