Incidental Mutation 'R5868:Nid1'
ID454293
Institutional Source Beutler Lab
Gene Symbol Nid1
Ensembl Gene ENSMUSG00000005397
Gene Namenidogen 1
Synonymsentactin 1, nidogen-1, entactin, entactin-1
MMRRC Submission 044076-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.206) question?
Stock #R5868 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location13437551-13512269 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 13489157 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000005532 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005532]
PDB Structure NIDOGEN-1 G2/PERLECAN IG3 COMPLEX [X-RAY DIFFRACTION]
DOMAIN G2 OF MOUSE NIDOGEN-1 [X-RAY DIFFRACTION]
Crystal structure of Nidogen/Laminin Complex [X-RAY DIFFRACTION]
Predicted Effect probably null
Transcript: ENSMUST00000005532
SMART Domains Protein: ENSMUSP00000005532
Gene: ENSMUSG00000005397

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
NIDO 106 270 3.8e-70 SMART
low complexity region 277 296 N/A INTRINSIC
EGF 387 424 3.46e0 SMART
G2F 425 664 7.69e-153 SMART
EGF 669 707 8.65e-1 SMART
EGF_CA 708 749 4.38e-11 SMART
EGF 759 799 8.19e-2 SMART
EGF_CA 800 838 1.42e-10 SMART
TY 873 921 1.17e-19 SMART
LY 968 1010 1.35e-2 SMART
LY 1011 1053 4.34e-15 SMART
LY 1054 1098 3.34e-16 SMART
LY 1099 1141 3.25e-5 SMART
LY 1142 1181 1.08e1 SMART
EGF 1209 1242 2.45e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222142
Meta Mutation Damage Score 0.9485 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.2%
  • 20x: 90.8%
Validation Efficiency 95% (58/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the nidogen family of basement membrane glycoproteins. The protein interacts with several other components of basement membranes, and may play a role in cell interactions with the extracellular matrix. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit neurologic deficits including seizure-like symptoms and loss of muscle control in the hind legs, and show altered basement membrane morphology in selected locations including brain capillaries and the lens capsule. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810408A11Rik C A 11: 69,897,575 K394N possibly damaging Het
4930451G09Rik T C 16: 4,974,068 noncoding transcript Het
Adamts18 T A 8: 113,777,748 Q80L possibly damaging Het
Apbb2 T A 5: 66,452,096 K69N probably damaging Het
Ascc3 C T 10: 50,842,183 R1991* probably null Het
BC035947 T A 1: 78,498,323 N524I probably damaging Het
Bpifa1 A G 2: 154,143,876 N37S unknown Het
Crnkl1 A T 2: 145,918,553 D648E probably benign Het
Cul5 C A 9: 53,658,673 G86V probably benign Het
Cyfip1 A C 7: 55,926,313 D1077A probably damaging Het
Dennd4a T C 9: 64,896,729 S1117P probably benign Het
Elmo2 A T 2: 165,294,272 M618K possibly damaging Het
Fam205c A T 4: 42,871,711 D221E probably damaging Het
Fggy A G 4: 95,696,988 T35A probably damaging Het
Gad2 G A 2: 22,685,067 probably null Het
Gtf3c2 A C 5: 31,168,081 F455V possibly damaging Het
Hacl1 C A 14: 31,619,916 A311S probably damaging Het
Hist4h4 C T 6: 136,804,294 G29D probably damaging Het
Kat6b G A 14: 21,634,479 D611N probably damaging Het
Kifap3 T C 1: 163,865,472 I611T probably damaging Het
Lrba A G 3: 86,319,604 Y683C probably damaging Het
Maats1 T A 16: 38,332,242 D202V probably damaging Het
Mfsd14a T C 3: 116,633,750 N413S probably benign Het
Mtmr11 T A 3: 96,171,202 D691E possibly damaging Het
Mzf1 A T 7: 13,053,189 F64I probably benign Het
Neu2 G T 1: 87,596,756 Q154H probably damaging Het
Nod1 C A 6: 54,939,327 K128N probably damaging Het
Noxred1 T A 12: 87,224,202 Q215L possibly damaging Het
Npat A G 9: 53,570,124 E1044G probably damaging Het
Npr1 A G 3: 90,459,493 probably benign Het
Pdcd6 T C 13: 74,304,014 D169G probably damaging Het
Pld3 G T 7: 27,537,668 T262N probably benign Het
Plxna1 T C 6: 89,322,722 probably benign Het
Prh1 A G 6: 132,572,211 Q227R unknown Het
Prtg C A 9: 72,809,717 Y113* probably null Het
Rbm27 T A 18: 42,300,385 V242E possibly damaging Het
Ripor1 T C 8: 105,616,004 L198P probably damaging Het
Rnpc3 T C 3: 113,616,711 probably null Het
Serpinf2 T C 11: 75,433,239 T321A probably benign Het
Sh3gl1 T C 17: 56,019,119 D129G probably damaging Het
Slc12a2 C A 18: 57,943,996 P1189Q probably damaging Het
Slc16a9 T C 10: 70,282,490 M213T probably benign Het
Svil G A 18: 5,056,854 probably null Het
Synpo A G 18: 60,604,046 L37P probably damaging Het
Tmprss9 A G 10: 80,882,746 H87R probably benign Het
Tmtc1 A T 6: 148,237,855 L885Q probably damaging Het
Ttc41 T C 10: 86,750,264 S811P possibly damaging Het
Vmn2r23 T C 6: 123,712,942 V259A probably benign Het
Wwox T A 8: 114,679,846 H192Q probably benign Het
Other mutations in Nid1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Nid1 APN 13 13476392 missense probably damaging 1.00
IGL02126:Nid1 APN 13 13489158 splice site probably null
IGL02452:Nid1 APN 13 13508720 missense probably benign 0.17
IGL02806:Nid1 APN 13 13468312 missense probably benign 0.00
IGL02966:Nid1 APN 13 13482221 missense probably benign 0.09
IGL03136:Nid1 APN 13 13500499 missense probably benign 0.33
IGL03411:Nid1 APN 13 13437889 missense probably damaging 0.98
R0384:Nid1 UTSW 13 13463836 missense probably benign 0.34
R0413:Nid1 UTSW 13 13482096 missense probably benign 0.01
R1257:Nid1 UTSW 13 13483790 missense probably benign 0.01
R1390:Nid1 UTSW 13 13476246 missense probably damaging 1.00
R1397:Nid1 UTSW 13 13508795 missense possibly damaging 0.94
R2057:Nid1 UTSW 13 13500473 missense probably benign 0.00
R2058:Nid1 UTSW 13 13500473 missense probably benign 0.00
R2059:Nid1 UTSW 13 13500473 missense probably benign 0.00
R2132:Nid1 UTSW 13 13509486 missense probably benign 0.04
R2140:Nid1 UTSW 13 13499668 missense probably damaging 1.00
R2195:Nid1 UTSW 13 13476203 missense probably damaging 1.00
R2237:Nid1 UTSW 13 13500485 missense probably benign
R2312:Nid1 UTSW 13 13500493 missense probably benign 0.15
R2987:Nid1 UTSW 13 13499673 missense probably benign 0.40
R3696:Nid1 UTSW 13 13486759 missense probably damaging 0.99
R3697:Nid1 UTSW 13 13486759 missense probably damaging 0.99
R3698:Nid1 UTSW 13 13486759 missense probably damaging 0.99
R3772:Nid1 UTSW 13 13476418 splice site probably benign
R4092:Nid1 UTSW 13 13486639 missense probably damaging 0.96
R4126:Nid1 UTSW 13 13476372 missense probably damaging 1.00
R4128:Nid1 UTSW 13 13476372 missense probably damaging 1.00
R4680:Nid1 UTSW 13 13472852 missense probably damaging 1.00
R4717:Nid1 UTSW 13 13506501 missense probably benign 0.00
R4783:Nid1 UTSW 13 13499741 missense probably damaging 0.97
R4812:Nid1 UTSW 13 13506468 nonsense probably null
R4834:Nid1 UTSW 13 13508823 missense probably damaging 1.00
R4915:Nid1 UTSW 13 13499586 missense possibly damaging 0.89
R4930:Nid1 UTSW 13 13510011 missense probably damaging 1.00
R5101:Nid1 UTSW 13 13483754 missense probably damaging 1.00
R5276:Nid1 UTSW 13 13468572 missense probably damaging 0.99
R5427:Nid1 UTSW 13 13483683 missense probably damaging 1.00
R5447:Nid1 UTSW 13 13437910 missense probably benign 0.00
R5507:Nid1 UTSW 13 13489037 nonsense probably null
R5663:Nid1 UTSW 13 13472834 missense probably damaging 1.00
R6313:Nid1 UTSW 13 13463782 missense probably benign 0.01
R6761:Nid1 UTSW 13 13482035 missense probably benign 0.22
R7069:Nid1 UTSW 13 13508768 missense probably benign
R7208:Nid1 UTSW 13 13468385 missense probably benign 0.01
R7284:Nid1 UTSW 13 13489090 missense probably benign 0.01
R7434:Nid1 UTSW 13 13468464 missense probably benign
R7449:Nid1 UTSW 13 13482051 missense probably damaging 1.00
R7574:Nid1 UTSW 13 13468443 missense probably benign
R7762:Nid1 UTSW 13 13489045 missense probably damaging 1.00
R7887:Nid1 UTSW 13 13499733 missense possibly damaging 0.83
R8420:Nid1 UTSW 13 13437831 missense possibly damaging 0.81
R8506:Nid1 UTSW 13 13476174 missense probably damaging 0.99
R8756:Nid1 UTSW 13 13508801 missense probably benign 0.32
X0028:Nid1 UTSW 13 13509534 missense probably benign 0.14
Predicted Primers PCR Primer
(F):5'- TTGGAAGGATAGCTGCCTGC -3'
(R):5'- AGGTCCCACATGAGGACAAC -3'

Sequencing Primer
(F):5'- AAGGCACACATTCATTTCTTTGTTC -3'
(R):5'- CCATCCAAGAAAATGCATAGTTCCAG -3'
Posted On2017-02-10