Incidental Mutation 'R5868:Pdcd6'
ID454294
Institutional Source Beutler Lab
Gene Symbol Pdcd6
Ensembl Gene ENSMUSG00000021576
Gene Nameprogrammed cell death 6
SynonymsPS2, Alg2, alg-2, MA-3
MMRRC Submission 044076-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5868 (G1)
Quality Score223
Status Validated
Chromosome13
Chromosomal Location74303509-74317580 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 74304014 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 169 (D169G)
Ref Sequence ENSEMBL: ENSMUSP00000152458 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022060] [ENSMUST00000222759]
Predicted Effect probably benign
Transcript: ENSMUST00000022060
AA Change: D171G

PolyPhen 2 Score 0.232 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000022060
Gene: ENSMUSG00000021576
AA Change: D171G

DomainStartEndE-ValueType
low complexity region 8 21 N/A INTRINSIC
EFh 27 55 1.76e0 SMART
EFh 64 92 2.98e1 SMART
EFh 94 122 1.4e-5 SMART
EFh 130 158 8.33e1 SMART
EFh 160 190 6.2e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220861
Predicted Effect probably damaging
Transcript: ENSMUST00000222759
AA Change: D169G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222993
Meta Mutation Damage Score 0.3096 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.2%
  • 20x: 90.8%
Validation Efficiency 95% (58/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a calcium-binding protein belonging to the penta-EF-hand protein family. Calcium binding is important for homodimerization and for conformational changes required for binding to other protein partners. This gene product participates in T cell receptor-, Fas-, and glucocorticoid-induced programmed cell death. In mice deficient for this gene product, however, apoptosis was not blocked suggesting this gene product is functionally redundant. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene, and a pseudogene of this gene is also located on the short arm of chromosome 5. [provided by RefSeq, May 2012]
PHENOTYPE: Mice homozygous for a targeted null mutation are viable, fertile and do not exhibit any developmental defects or immune dysfunction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810408A11Rik C A 11: 69,897,575 K394N possibly damaging Het
4930451G09Rik T C 16: 4,974,068 noncoding transcript Het
Adamts18 T A 8: 113,777,748 Q80L possibly damaging Het
Apbb2 T A 5: 66,452,096 K69N probably damaging Het
Ascc3 C T 10: 50,842,183 R1991* probably null Het
BC035947 T A 1: 78,498,323 N524I probably damaging Het
Bpifa1 A G 2: 154,143,876 N37S unknown Het
Crnkl1 A T 2: 145,918,553 D648E probably benign Het
Cul5 C A 9: 53,658,673 G86V probably benign Het
Cyfip1 A C 7: 55,926,313 D1077A probably damaging Het
Dennd4a T C 9: 64,896,729 S1117P probably benign Het
Elmo2 A T 2: 165,294,272 M618K possibly damaging Het
Fam205c A T 4: 42,871,711 D221E probably damaging Het
Fggy A G 4: 95,696,988 T35A probably damaging Het
Gad2 G A 2: 22,685,067 probably null Het
Gtf3c2 A C 5: 31,168,081 F455V possibly damaging Het
Hacl1 C A 14: 31,619,916 A311S probably damaging Het
Hist4h4 C T 6: 136,804,294 G29D probably damaging Het
Kat6b G A 14: 21,634,479 D611N probably damaging Het
Kifap3 T C 1: 163,865,472 I611T probably damaging Het
Lrba A G 3: 86,319,604 Y683C probably damaging Het
Maats1 T A 16: 38,332,242 D202V probably damaging Het
Mfsd14a T C 3: 116,633,750 N413S probably benign Het
Mtmr11 T A 3: 96,171,202 D691E possibly damaging Het
Mzf1 A T 7: 13,053,189 F64I probably benign Het
Neu2 G T 1: 87,596,756 Q154H probably damaging Het
Nid1 T C 13: 13,489,157 probably null Het
Nod1 C A 6: 54,939,327 K128N probably damaging Het
Noxred1 T A 12: 87,224,202 Q215L possibly damaging Het
Npat A G 9: 53,570,124 E1044G probably damaging Het
Npr1 A G 3: 90,459,493 probably benign Het
Pld3 G T 7: 27,537,668 T262N probably benign Het
Plxna1 T C 6: 89,322,722 probably benign Het
Prh1 A G 6: 132,572,211 Q227R unknown Het
Prtg C A 9: 72,809,717 Y113* probably null Het
Rbm27 T A 18: 42,300,385 V242E possibly damaging Het
Ripor1 T C 8: 105,616,004 L198P probably damaging Het
Rnpc3 T C 3: 113,616,711 probably null Het
Serpinf2 T C 11: 75,433,239 T321A probably benign Het
Sh3gl1 T C 17: 56,019,119 D129G probably damaging Het
Slc12a2 C A 18: 57,943,996 P1189Q probably damaging Het
Slc16a9 T C 10: 70,282,490 M213T probably benign Het
Svil G A 18: 5,056,854 probably null Het
Synpo A G 18: 60,604,046 L37P probably damaging Het
Tmprss9 A G 10: 80,882,746 H87R probably benign Het
Tmtc1 A T 6: 148,237,855 L885Q probably damaging Het
Ttc41 T C 10: 86,750,264 S811P possibly damaging Het
Vmn2r23 T C 6: 123,712,942 V259A probably benign Het
Wwox T A 8: 114,679,846 H192Q probably benign Het
Other mutations in Pdcd6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02573:Pdcd6 APN 13 74303979 missense probably damaging 1.00
IGL03029:Pdcd6 APN 13 74309780 missense probably damaging 1.00
R0379:Pdcd6 UTSW 13 74309712 missense possibly damaging 0.81
R0744:Pdcd6 UTSW 13 74316324 splice site probably benign
R0833:Pdcd6 UTSW 13 74316324 splice site probably benign
R1739:Pdcd6 UTSW 13 74304041 missense probably damaging 1.00
R1779:Pdcd6 UTSW 13 74305581 missense probably damaging 0.99
R1983:Pdcd6 UTSW 13 74304000 missense probably benign 0.05
R4665:Pdcd6 UTSW 13 74317206 start codon destroyed probably null 0.02
R6329:Pdcd6 UTSW 13 74303979 missense probably damaging 1.00
R6848:Pdcd6 UTSW 13 74309840 missense possibly damaging 0.56
Predicted Primers PCR Primer
(F):5'- TGAACGATACAGCCAACGGG -3'
(R):5'- GGTTCTGACTAAAGGTGTTCAAG -3'

Sequencing Primer
(F):5'- GAAGGACGGCATCTCACTG -3'
(R):5'- GTGTTCAAGAGTACTCAACCCGTG -3'
Posted On2017-02-10