Incidental Mutation 'R5868:Hacl1'
ID454296
Institutional Source Beutler Lab
Gene Symbol Hacl1
Ensembl Gene ENSMUSG00000021884
Gene Name2-hydroxyacyl-CoA lyase 1
SynonymsHpcl, Phyh2
MMRRC Submission 044076-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5868 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location31598730-31641286 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 31619916 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 311 (A311S)
Ref Sequence ENSEMBL: ENSMUSP00000114922 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022437] [ENSMUST00000127204] [ENSMUST00000156431] [ENSMUST00000165955] [ENSMUST00000167066] [ENSMUST00000167175] [ENSMUST00000171414]
Predicted Effect probably damaging
Transcript: ENSMUST00000022437
AA Change: A311S

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000022437
Gene: ENSMUSG00000021884
AA Change: A311S

DomainStartEndE-ValueType
Pfam:TPP_enzyme_N 17 185 6.1e-46 PFAM
Pfam:TPP_enzyme_M 206 335 1.9e-34 PFAM
Pfam:TPP_enzyme_C 400 560 1.6e-27 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000127204
AA Change: A284S

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000120452
Gene: ENSMUSG00000021884
AA Change: A284S

DomainStartEndE-ValueType
Pfam:TPP_enzyme_N 17 81 1.3e-14 PFAM
Pfam:TPP_enzyme_N 75 159 3.3e-14 PFAM
Pfam:TPP_enzyme_M 179 310 1.5e-34 PFAM
Pfam:TPP_enzyme_C 373 533 7.2e-28 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000156431
AA Change: A311S

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000114922
Gene: ENSMUSG00000021884
AA Change: A311S

DomainStartEndE-ValueType
Pfam:TPP_enzyme_N 17 186 3.3e-46 PFAM
Pfam:TPP_enzyme_M 206 337 2.1e-34 PFAM
Pfam:TPP_enzyme_C 400 560 1.6e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165955
SMART Domains Protein: ENSMUSP00000129090
Gene: ENSMUSG00000021884

DomainStartEndE-ValueType
Pfam:TPP_enzyme_N 17 105 3.7e-28 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000167066
AA Change: A285S

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000132913
Gene: ENSMUSG00000021884
AA Change: A285S

DomainStartEndE-ValueType
Pfam:TPP_enzyme_N 17 131 2.5e-33 PFAM
Pfam:TPP_enzyme_M 180 311 4.7e-34 PFAM
Pfam:TPP_enzyme_C 340 500 6.4e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000167175
SMART Domains Protein: ENSMUSP00000128588
Gene: ENSMUSG00000115022

DomainStartEndE-ValueType
Pfam:TPP_enzyme_N 17 139 3.6e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171414
SMART Domains Protein: ENSMUSP00000130268
Gene: ENSMUSG00000021884

DomainStartEndE-ValueType
Pfam:TPP_enzyme_N 17 109 1.3e-27 PFAM
Meta Mutation Damage Score 0.6279 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.2%
  • 20x: 90.8%
Validation Efficiency 95% (58/61)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810408A11Rik C A 11: 69,897,575 K394N possibly damaging Het
4930451G09Rik T C 16: 4,974,068 noncoding transcript Het
Adamts18 T A 8: 113,777,748 Q80L possibly damaging Het
Apbb2 T A 5: 66,452,096 K69N probably damaging Het
Ascc3 C T 10: 50,842,183 R1991* probably null Het
BC035947 T A 1: 78,498,323 N524I probably damaging Het
Bpifa1 A G 2: 154,143,876 N37S unknown Het
Crnkl1 A T 2: 145,918,553 D648E probably benign Het
Cul5 C A 9: 53,658,673 G86V probably benign Het
Cyfip1 A C 7: 55,926,313 D1077A probably damaging Het
Dennd4a T C 9: 64,896,729 S1117P probably benign Het
Elmo2 A T 2: 165,294,272 M618K possibly damaging Het
Fam205c A T 4: 42,871,711 D221E probably damaging Het
Fggy A G 4: 95,696,988 T35A probably damaging Het
Gad2 G A 2: 22,685,067 probably null Het
Gtf3c2 A C 5: 31,168,081 F455V possibly damaging Het
Hist4h4 C T 6: 136,804,294 G29D probably damaging Het
Kat6b G A 14: 21,634,479 D611N probably damaging Het
Kifap3 T C 1: 163,865,472 I611T probably damaging Het
Lrba A G 3: 86,319,604 Y683C probably damaging Het
Maats1 T A 16: 38,332,242 D202V probably damaging Het
Mfsd14a T C 3: 116,633,750 N413S probably benign Het
Mtmr11 T A 3: 96,171,202 D691E possibly damaging Het
Mzf1 A T 7: 13,053,189 F64I probably benign Het
Neu2 G T 1: 87,596,756 Q154H probably damaging Het
Nid1 T C 13: 13,489,157 probably null Het
Nod1 C A 6: 54,939,327 K128N probably damaging Het
Noxred1 T A 12: 87,224,202 Q215L possibly damaging Het
Npat A G 9: 53,570,124 E1044G probably damaging Het
Npr1 A G 3: 90,459,493 probably benign Het
Pdcd6 T C 13: 74,304,014 D169G probably damaging Het
Pld3 G T 7: 27,537,668 T262N probably benign Het
Plxna1 T C 6: 89,322,722 probably benign Het
Prh1 A G 6: 132,572,211 Q227R unknown Het
Prtg C A 9: 72,809,717 Y113* probably null Het
Rbm27 T A 18: 42,300,385 V242E possibly damaging Het
Ripor1 T C 8: 105,616,004 L198P probably damaging Het
Rnpc3 T C 3: 113,616,711 probably null Het
Serpinf2 T C 11: 75,433,239 T321A probably benign Het
Sh3gl1 T C 17: 56,019,119 D129G probably damaging Het
Slc12a2 C A 18: 57,943,996 P1189Q probably damaging Het
Slc16a9 T C 10: 70,282,490 M213T probably benign Het
Svil G A 18: 5,056,854 probably null Het
Synpo A G 18: 60,604,046 L37P probably damaging Het
Tmprss9 A G 10: 80,882,746 H87R probably benign Het
Tmtc1 A T 6: 148,237,855 L885Q probably damaging Het
Ttc41 T C 10: 86,750,264 S811P possibly damaging Het
Vmn2r23 T C 6: 123,712,942 V259A probably benign Het
Wwox T A 8: 114,679,846 H192Q probably benign Het
Other mutations in Hacl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01358:Hacl1 APN 14 31626417 missense probably benign 0.04
IGL01548:Hacl1 APN 14 31640596 missense possibly damaging 0.78
IGL01952:Hacl1 APN 14 31641122 unclassified probably benign
IGL02059:Hacl1 APN 14 31632934 missense probably benign 0.00
IGL02138:Hacl1 APN 14 31630983 missense probably benign 0.05
IGL02637:Hacl1 APN 14 31640501 missense probably damaging 1.00
IGL03235:Hacl1 APN 14 31631038 nonsense probably null
R0502:Hacl1 UTSW 14 31622984 splice site probably benign
R1697:Hacl1 UTSW 14 31621000 splice site probably null
R1800:Hacl1 UTSW 14 31614264 missense probably damaging 1.00
R1829:Hacl1 UTSW 14 31640534 missense probably benign 0.00
R3937:Hacl1 UTSW 14 31634191 splice site probably benign
R3938:Hacl1 UTSW 14 31634191 splice site probably benign
R5004:Hacl1 UTSW 14 31619039 missense probably benign
R5776:Hacl1 UTSW 14 31622871 missense possibly damaging 0.90
R5929:Hacl1 UTSW 14 31616388 missense probably benign 0.04
R6261:Hacl1 UTSW 14 31635771 missense probably damaging 1.00
R6996:Hacl1 UTSW 14 31615423 missense possibly damaging 0.96
R7298:Hacl1 UTSW 14 31616486 missense probably damaging 1.00
R7768:Hacl1 UTSW 14 31616480 missense probably damaging 1.00
R7887:Hacl1 UTSW 14 31634227 missense probably damaging 1.00
R8384:Hacl1 UTSW 14 31634197 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TGACTAGACATGCCACCAAGTA -3'
(R):5'- TTCCTAAAGGATTTTAAGAGCAAACA -3'

Sequencing Primer
(F):5'- GTAAATCAAAAGGAGCCTTGTCC -3'
(R):5'- TCGTTGGATACCAGGCATAC -3'
Posted On2017-02-10