Incidental Mutation 'R5869:Exo1'
ID454308
Institutional Source Beutler Lab
Gene Symbol Exo1
Ensembl Gene ENSMUSG00000039748
Gene Nameexonuclease 1
Synonyms5730442G03Rik, Msa
MMRRC Submission 044077-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.492) question?
Stock #R5869 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location175880581-175913489 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 175901283 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 638 (S638P)
Ref Sequence ENSEMBL: ENSMUSP00000039376 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039725]
Predicted Effect possibly damaging
Transcript: ENSMUST00000039725
AA Change: S638P

PolyPhen 2 Score 0.592 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000039376
Gene: ENSMUSG00000039748
AA Change: S638P

DomainStartEndE-ValueType
XPGN 1 99 6.24e-38 SMART
XPGI 138 208 4.56e-31 SMART
HhH2 212 245 2.28e-8 SMART
Blast:XPGI 252 288 4e-16 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180129
Predicted Effect probably benign
Transcript: ENSMUST00000191680
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193610
Predicted Effect probably benign
Transcript: ENSMUST00000194636
Predicted Effect probably benign
Transcript: ENSMUST00000194816
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.1%
Validation Efficiency 93% (68/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with 5' to 3' exonuclease activity as well as an RNase H activity. It is similar to the Saccharomyces cerevisiae protein Exo1 which interacts with Msh2 and which is involved in mismatch repair and recombination. Alternative splicing of this gene results in three transcript variants encoding two different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in reduced life span, lymphoma development, and male/female sterilty due to defective meiosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adarb1 T C 10: 77,325,616 probably benign Het
Arsk T C 13: 76,091,784 E100G probably benign Het
Ascc3 C T 10: 50,842,183 R1991* probably null Het
Aspscr1 T C 11: 120,688,920 I31T possibly damaging Het
Asz1 T C 6: 18,074,940 probably benign Het
Calm5 T A 13: 3,854,321 probably benign Het
Car5a G A 8: 121,916,380 T295I probably benign Het
Ccdc174 T A 6: 91,885,418 probably benign Het
Celsr2 G A 3: 108,413,909 A529V probably damaging Het
Cep192 A G 18: 67,815,864 D252G probably benign Het
Clcnka A G 4: 141,394,965 F217L probably benign Het
Cnot3 A T 7: 3,644,930 probably benign Het
Coro1c A G 5: 113,850,846 probably benign Het
Cstf3 A G 2: 104,659,240 probably null Het
Dcdc2a C T 13: 25,107,730 P233S probably benign Het
Ddx55 A G 5: 124,568,682 T581A probably benign Het
Fam135a T C 1: 24,029,430 E616G possibly damaging Het
Fignl2 T C 15: 101,053,280 S374G unknown Het
Gm4799 A T 10: 82,954,449 noncoding transcript Het
Hectd4 T C 5: 121,343,225 probably null Het
Ighv1-76 T C 12: 115,848,038 E65G probably damaging Het
Igsf9b C A 9: 27,323,235 H465Q probably benign Het
Itga9 A G 9: 118,663,889 D284G probably damaging Het
Itpr1 T C 6: 108,473,529 S1940P probably benign Het
Kcnb1 A G 2: 167,188,071 S185P probably benign Het
Kif20a G A 18: 34,632,415 A822T probably benign Het
Krt1 A T 15: 101,850,131 F199L probably damaging Het
Lpin2 A G 17: 71,232,276 probably benign Het
Lrp1b A C 2: 41,004,603 D2204E probably damaging Het
Mier3 T A 13: 111,714,850 N427K probably damaging Het
Mmp12 GTAATAATAATAATAATAAT GTAATAATAATAATAAT 9: 7,348,446 probably benign Het
Mroh3 T A 1: 136,186,123 M643L probably benign Het
Myh11 A G 16: 14,230,800 S548P probably damaging Het
Nat8f6 A C 6: 85,808,523 L215V possibly damaging Het
Nlrp3 G A 11: 59,548,134 R179Q probably damaging Het
Nup88 T C 11: 70,969,671 E94G probably benign Het
Pias1 A T 9: 62,912,766 D306E probably benign Het
Pick1 A G 15: 79,248,895 D385G probably benign Het
Pitx3 A T 19: 46,137,296 probably benign Het
Plpp3 T A 4: 105,194,962 probably null Het
Prlhr C A 19: 60,467,621 R169L probably damaging Het
Ptprf A C 4: 118,210,382 M1872R probably damaging Het
Ptprh T C 7: 4,601,940 D35G probably benign Het
Rnf130 A G 11: 50,085,815 probably null Het
Rnf17 A C 14: 56,505,988 E1337A possibly damaging Het
Sdk2 A G 11: 113,851,882 Y734H probably damaging Het
Slc25a10 C T 11: 120,498,117 T269I probably damaging Het
Slc4a11 A C 2: 130,684,459 V855G probably benign Het
Slc5a5 C A 8: 70,892,330 R111L probably damaging Het
Spg20 A T 3: 55,135,510 M616L probably benign Het
Tmem229a T C 6: 24,954,687 D356G probably damaging Het
Tmem30c A G 16: 57,266,562 S293P probably damaging Het
Tnfrsf14 C A 4: 154,926,598 probably null Het
Tnfrsf19 C T 14: 60,971,178 R298H possibly damaging Het
Ttc21a A G 9: 119,958,792 K809E probably benign Het
Ttn G A 2: 76,750,209 P23447S probably damaging Het
Uap1 T A 1: 170,151,138 probably null Het
Wdr82 A G 9: 106,185,304 Q252R probably benign Het
Zfp523 T C 17: 28,194,993 I34T probably benign Het
Zfp808 T A 13: 62,171,255 H99Q probably damaging Het
Other mutations in Exo1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00819:Exo1 APN 1 175896237 missense probably benign 0.00
IGL01116:Exo1 APN 1 175901397 missense possibly damaging 0.76
IGL01766:Exo1 APN 1 175892021 missense possibly damaging 0.67
IGL02117:Exo1 APN 1 175893743 missense possibly damaging 0.60
IGL02979:Exo1 APN 1 175899407 missense probably damaging 1.00
IGL03026:Exo1 APN 1 175908437 makesense probably null
IGL03109:Exo1 APN 1 175899560 missense probably damaging 1.00
IGL03208:Exo1 APN 1 175896245 missense probably benign 0.01
IGL03342:Exo1 APN 1 175892127 missense probably benign 0.09
IGL03147:Exo1 UTSW 1 175888788 missense probably damaging 1.00
R0194:Exo1 UTSW 1 175892030 missense probably damaging 1.00
R0427:Exo1 UTSW 1 175905953 missense probably damaging 0.96
R0520:Exo1 UTSW 1 175899465 missense probably benign 0.00
R1382:Exo1 UTSW 1 175893796 missense probably damaging 0.98
R1618:Exo1 UTSW 1 175901386 missense probably benign 0.00
R1666:Exo1 UTSW 1 175908486 missense possibly damaging 0.81
R2007:Exo1 UTSW 1 175908530 missense probably damaging 1.00
R2177:Exo1 UTSW 1 175882890 splice site probably null
R2224:Exo1 UTSW 1 175886688 critical splice acceptor site probably null
R2305:Exo1 UTSW 1 175888761 missense probably damaging 1.00
R2509:Exo1 UTSW 1 175905833 missense probably damaging 1.00
R3405:Exo1 UTSW 1 175905970 missense possibly damaging 0.89
R3406:Exo1 UTSW 1 175905970 missense possibly damaging 0.89
R3711:Exo1 UTSW 1 175893829 missense probably benign
R3767:Exo1 UTSW 1 175886746 missense probably damaging 1.00
R3787:Exo1 UTSW 1 175899469 missense probably benign
R3853:Exo1 UTSW 1 175892988 missense probably benign 0.01
R5304:Exo1 UTSW 1 175892976 missense probably damaging 1.00
R5625:Exo1 UTSW 1 175893814 missense possibly damaging 0.51
R7013:Exo1 UTSW 1 175893772 missense probably damaging 1.00
R7238:Exo1 UTSW 1 175888847 missense probably damaging 1.00
R7514:Exo1 UTSW 1 175906666 splice site probably null
R7522:Exo1 UTSW 1 175901304 missense probably benign 0.08
R7895:Exo1 UTSW 1 175900996 missense probably benign 0.06
R8218:Exo1 UTSW 1 175900914 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GATTCCAGGCAATGCAGCTG -3'
(R):5'- ACGTACCTCTGAACCTGAATCC -3'

Sequencing Primer
(F):5'- CAATGCAGCTGTGTCTCCTGAG -3'
(R):5'- CTGAACCTGAATCCCTACTGG -3'
Posted On2017-02-10