Incidental Mutation 'R0555:Fubp3'
ID45431
Institutional Source Beutler Lab
Gene Symbol Fubp3
Ensembl Gene ENSMUSG00000026843
Gene Namefar upstream element (FUSE) binding protein 3
SynonymsA330051M14Rik, FBP3, Marta2
MMRRC Submission 038747-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.687) question?
Stock #R0555 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location31572651-31617526 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 31608137 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 101 (R101H)
Ref Sequence ENSEMBL: ENSMUSP00000141283 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055244] [ENSMUST00000113482] [ENSMUST00000134553]
Predicted Effect probably damaging
Transcript: ENSMUST00000055244
AA Change: R343H

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000053474
Gene: ENSMUSG00000026843
AA Change: R343H

DomainStartEndE-ValueType
KH 76 146 2.21e-18 SMART
KH 161 233 1.29e-19 SMART
KH 252 322 9.69e-15 SMART
low complexity region 330 343 N/A INTRINSIC
KH 353 426 3.48e-16 SMART
low complexity region 490 514 N/A INTRINSIC
low complexity region 529 538 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000113482
AA Change: R343H

PolyPhen 2 Score 0.919 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000109110
Gene: ENSMUSG00000026843
AA Change: R343H

DomainStartEndE-ValueType
KH 76 146 2.21e-18 SMART
KH 161 233 1.29e-19 SMART
KH 252 322 9.69e-15 SMART
low complexity region 330 343 N/A INTRINSIC
KH 353 426 3.48e-16 SMART
low complexity region 490 514 N/A INTRINSIC
low complexity region 529 538 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000129903
AA Change: R55H
SMART Domains Protein: ENSMUSP00000117970
Gene: ENSMUSG00000026843
AA Change: R55H

DomainStartEndE-ValueType
Blast:KH 2 35 5e-16 BLAST
low complexity region 43 56 N/A INTRINSIC
KH 66 139 3.48e-16 SMART
low complexity region 213 227 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000134553
AA Change: R101H

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000141283
Gene: ENSMUSG00000026843
AA Change: R101H

DomainStartEndE-ValueType
KH 10 80 5.9e-17 SMART
low complexity region 88 101 N/A INTRINSIC
KH 111 184 2.2e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000150473
SMART Domains Protein: ENSMUSP00000123589
Gene: ENSMUSG00000026843

DomainStartEndE-ValueType
Pfam:DUF1897 39 66 2.8e-8 PFAM
Pfam:DUF1897 66 88 3.2e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183343
Meta Mutation Damage Score 0.1601 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.8%
  • 10x: 96.9%
  • 20x: 93.8%
Validation Efficiency 100% (98/98)
Allele List at MGI
Other mutations in this stock
Total: 96 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam10 T A 9: 70,754,234 I363N probably damaging Het
Ahcyl2 T C 6: 29,890,671 probably benign Het
Asap1 A G 15: 64,094,364 L941P probably damaging Het
Aurka G A 2: 172,367,147 R23C probably benign Het
Cacna1c C T 6: 118,612,625 R1446H probably damaging Het
Casp8ap2 T A 4: 32,640,381 H478Q probably damaging Het
Clcn4 C T 7: 7,290,504 A418T possibly damaging Het
Cpxm2 A T 7: 132,044,043 Y715* probably null Het
Csmd1 T C 8: 16,185,273 M1179V probably benign Het
Ddx21 A T 10: 62,587,528 F632I probably damaging Het
Dnaic1 C A 4: 41,625,335 T433K possibly damaging Het
Dpyd G A 3: 119,431,542 G988D probably damaging Het
Dync1i2 AAAAGAAGAGGAAAGAAGAGGAAAG AAAAGAAGAGGAAAG 2: 71,214,518 probably null Het
Dync1li2 A T 8: 104,420,665 S466T probably benign Het
Ears2 T C 7: 122,048,444 T206A probably benign Het
Elmod1 A T 9: 53,931,592 probably benign Het
Eps8l3 C A 3: 107,892,345 D590E probably benign Het
Etfdh A T 3: 79,605,805 H370Q probably benign Het
Fam83g C A 11: 61,707,663 A792E probably benign Het
Ffar3 G T 7: 30,855,537 Y119* probably null Het
Fosb G T 7: 19,307,213 S118R possibly damaging Het
Foxn4 G A 5: 114,263,114 L3F probably damaging Het
Foxo4 A G X: 101,255,178 K65E probably damaging Het
Frem2 A G 3: 53,516,860 L3052P probably damaging Het
Gba2 C A 4: 43,569,927 G429C probably damaging Het
Gimap1 T C 6: 48,741,429 probably benign Het
Gm17657 A T 17: 29,519,571 F74I probably benign Het
Gnas A G 2: 174,298,511 T158A possibly damaging Het
Gpc5 T C 14: 115,552,328 V538A probably damaging Het
Greb1l T C 18: 10,458,781 probably benign Het
H2-M10.5 G A 17: 36,774,728 G260R probably damaging Het
Hbs1l A C 10: 21,349,323 Q412H probably benign Het
Hecw1 G T 13: 14,236,941 T1058N probably damaging Het
Heph A T X: 96,558,084 T1027S probably damaging Het
Hoga1 A C 19: 42,046,075 E53A possibly damaging Het
Insrr T G 3: 87,814,437 probably benign Het
Ipo11 A T 13: 106,892,461 V328D probably damaging Het
Jakmip1 T C 5: 37,118,873 V509A probably damaging Het
Jmjd1c T C 10: 67,225,789 V1307A probably benign Het
Kmt2a T A 9: 44,847,571 S1027C probably damaging Het
Kprp G C 3: 92,824,357 P462R unknown Het
Lman1l T C 9: 57,614,101 T193A probably benign Het
Lrit3 A T 3: 129,791,296 V271D probably damaging Het
Map4 T A 9: 109,979,103 probably benign Het
Mark4 A C 7: 19,448,673 probably benign Het
Mfsd14b A G 13: 65,078,445 V142A probably benign Het
Mis18bp1 A T 12: 65,161,453 I162N possibly damaging Het
Mrpl43 A T 19: 45,005,952 probably benign Het
Mrpl47 A G 3: 32,736,693 F16S probably benign Het
Myh2 G T 11: 67,178,967 G380C probably damaging Het
Myo15 T C 11: 60,521,638 Y3284H probably damaging Het
Nectin2 A G 7: 19,733,223 probably benign Het
Neu3 A G 7: 99,814,183 V111A probably damaging Het
Nol4l T C 2: 153,417,684 probably null Het
Nphp3 C A 9: 104,023,434 H510Q probably damaging Het
Nprl3 T A 11: 32,233,118 probably null Het
Olfr292 A G 7: 86,695,308 N284S probably damaging Het
Olfr48 T C 2: 89,844,443 T177A probably benign Het
Olfr598 T C 7: 103,328,963 V159A probably benign Het
Olfr791 T C 10: 129,526,896 I223T possibly damaging Het
Pex1 A G 5: 3,606,130 E319G possibly damaging Het
Phtf1 C A 3: 104,004,469 T709K probably damaging Het
Plek2 A T 12: 78,892,172 L271Q probably damaging Het
Plekhg5 T A 4: 152,107,469 C421* probably null Het
Polk A C 13: 96,484,179 C525W probably damaging Het
Ppfibp2 T C 7: 107,729,174 S471P probably damaging Het
Prickle2 A T 6: 92,458,565 F74L probably benign Het
Prl7d1 A T 13: 27,712,055 V113D probably benign Het
Prr14 C T 7: 127,472,095 probably benign Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Ret A G 6: 118,178,610 V375A probably damaging Het
Rora T C 9: 69,361,746 F41S probably damaging Het
Sall1 T C 8: 89,031,758 T573A probably benign Het
Shb A G 4: 45,458,321 V281A possibly damaging Het
Slc25a26 A T 6: 94,592,410 probably null Het
Sltm T C 9: 70,586,081 F769L probably damaging Het
Snx9 T A 17: 5,918,413 M328K probably damaging Het
Stk25 G T 1: 93,624,591 Q356K probably benign Het
Svep1 T A 4: 58,128,858 Y613F possibly damaging Het
Syne4 G A 7: 30,316,744 A195T probably damaging Het
Tmem8 T C 17: 26,117,114 L130S probably benign Het
Trcg1 C T 9: 57,242,333 T396M probably damaging Het
Trim30b A G 7: 104,357,298 V117A possibly damaging Het
Trpc4 T C 3: 54,302,090 probably benign Het
Ttll4 A G 1: 74,688,280 H827R probably damaging Het
Urgcp T C 11: 5,717,477 E287G probably damaging Het
Usp2 G T 9: 44,092,784 L319F probably damaging Het
Vmn1r167 A T 7: 23,505,087 V168D probably damaging Het
Vmn2r100 C A 17: 19,522,120 P252Q possibly damaging Het
Vmn2r61 A T 7: 42,266,018 I130F probably benign Het
Vmn2r63 A T 7: 42,928,528 Y195* probably null Het
Vmn2r81 T C 10: 79,293,449 S725P probably damaging Het
Wnt10b A G 15: 98,772,937 probably benign Het
Zcchc6 A G 13: 59,800,317 V328A probably benign Het
Zfp292 T C 4: 34,807,194 E1950G probably damaging Het
Zfyve16 A G 13: 92,516,520 probably benign Het
Other mutations in Fubp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01402:Fubp3 APN 2 31604721 splice site probably null
IGL01583:Fubp3 APN 2 31611743 unclassified probably benign
IGL02532:Fubp3 APN 2 31600559 unclassified probably benign
IGL02709:Fubp3 APN 2 31595331 splice site probably benign
R0140:Fubp3 UTSW 2 31608184 missense probably damaging 1.00
R1303:Fubp3 UTSW 2 31600520 missense probably damaging 1.00
R1439:Fubp3 UTSW 2 31598551 missense probably damaging 1.00
R1447:Fubp3 UTSW 2 31600547 missense probably damaging 0.99
R1789:Fubp3 UTSW 2 31611735 missense possibly damaging 0.62
R1973:Fubp3 UTSW 2 31603286 missense probably benign
R2141:Fubp3 UTSW 2 31600557 unclassified probably benign
R4708:Fubp3 UTSW 2 31608110 missense probably benign 0.01
R4780:Fubp3 UTSW 2 31583211 missense probably damaging 0.99
R4836:Fubp3 UTSW 2 31608141 missense possibly damaging 0.93
R5468:Fubp3 UTSW 2 31603235 missense probably benign
R5851:Fubp3 UTSW 2 31598610 missense probably benign
R6778:Fubp3 UTSW 2 31598673 missense possibly damaging 0.93
R7074:Fubp3 UTSW 2 31595294 missense probably damaging 1.00
R7170:Fubp3 UTSW 2 31598620 missense probably benign 0.00
R7317:Fubp3 UTSW 2 31604612 critical splice acceptor site probably null
R8381:Fubp3 UTSW 2 31592497 critical splice donor site probably null
X0022:Fubp3 UTSW 2 31583224 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGAATGCCAGCTTCTGAGTCTGAG -3'
(R):5'- GGACGTGCTTTACCTCCATGATGAC -3'

Sequencing Primer
(F):5'- CAGCTTCTGAGTCTGAGACATTG -3'
(R):5'- TTACCTCCATGATGACAAGTCAGG -3'
Posted On2013-06-11