Incidental Mutation 'R5869:Clcnka'
ID454318
Institutional Source Beutler Lab
Gene Symbol Clcnka
Ensembl Gene ENSMUSG00000033770
Gene Namechloride channel, voltage-sensitive Ka
SynonymsCLC-K1, Clcnk1
MMRRC Submission 044077-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5869 (G1)
Quality Score209
Status Validated
Chromosome4
Chromosomal Location141384610-141398724 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 141394965 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 217 (F217L)
Ref Sequence ENSEMBL: ENSMUSP00000101416 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042617] [ENSMUST00000105790] [ENSMUST00000133676]
Predicted Effect probably benign
Transcript: ENSMUST00000042617
AA Change: F217L

PolyPhen 2 Score 0.084 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000048520
Gene: ENSMUSG00000033770
AA Change: F217L

DomainStartEndE-ValueType
low complexity region 23 35 N/A INTRINSIC
Pfam:Voltage_CLC 102 514 2.1e-69 PFAM
CBS 554 604 6.54e-6 SMART
Pfam:CBS 623 679 5.7e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105790
AA Change: F217L

PolyPhen 2 Score 0.084 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000101416
Gene: ENSMUSG00000033770
AA Change: F217L

DomainStartEndE-ValueType
low complexity region 23 35 N/A INTRINSIC
Pfam:Voltage_CLC 101 514 3.1e-75 PFAM
CBS 554 604 6.54e-6 SMART
Blast:CBS 629 678 1e-20 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000133676
SMART Domains Protein: ENSMUSP00000122396
Gene: ENSMUSG00000033770

DomainStartEndE-ValueType
low complexity region 23 35 N/A INTRINSIC
Pfam:Voltage_CLC 101 191 1.6e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148320
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149247
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150334
Meta Mutation Damage Score 0.1176 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.1%
Validation Efficiency 93% (68/73)
MGI Phenotype FUNCTION: This gene is a member of the CLC family of voltage-gated chloride channels. The gene is located adjacent to a highly similar chloride channel gene on chromosome 4. This gene is syntenic with human CLCNKB (geneID:1188). Multiple alternatively spliced variants, encoding the same protein, have been found for this gene. [provided by RefSeq, Sep 2009]
PHENOTYPE: Homozygous mutation of this gene results in increased urine volume and decreased urine osmolarity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adarb1 T C 10: 77,325,616 probably benign Het
Arsk T C 13: 76,091,784 E100G probably benign Het
Ascc3 C T 10: 50,842,183 R1991* probably null Het
Aspscr1 T C 11: 120,688,920 I31T possibly damaging Het
Asz1 T C 6: 18,074,940 probably benign Het
Calm5 T A 13: 3,854,321 probably benign Het
Car5a G A 8: 121,916,380 T295I probably benign Het
Ccdc174 T A 6: 91,885,418 probably benign Het
Celsr2 G A 3: 108,413,909 A529V probably damaging Het
Cep192 A G 18: 67,815,864 D252G probably benign Het
Cnot3 A T 7: 3,644,930 probably benign Het
Coro1c A G 5: 113,850,846 probably benign Het
Cstf3 A G 2: 104,659,240 probably null Het
Dcdc2a C T 13: 25,107,730 P233S probably benign Het
Ddx55 A G 5: 124,568,682 T581A probably benign Het
Exo1 T C 1: 175,901,283 S638P possibly damaging Het
Fam135a T C 1: 24,029,430 E616G possibly damaging Het
Fignl2 T C 15: 101,053,280 S374G unknown Het
Gm4799 A T 10: 82,954,449 noncoding transcript Het
Hectd4 T C 5: 121,343,225 probably null Het
Ighv1-76 T C 12: 115,848,038 E65G probably damaging Het
Igsf9b C A 9: 27,323,235 H465Q probably benign Het
Itga9 A G 9: 118,663,889 D284G probably damaging Het
Itpr1 T C 6: 108,473,529 S1940P probably benign Het
Kcnb1 A G 2: 167,188,071 S185P probably benign Het
Kif20a G A 18: 34,632,415 A822T probably benign Het
Krt1 A T 15: 101,850,131 F199L probably damaging Het
Lpin2 A G 17: 71,232,276 probably benign Het
Lrp1b A C 2: 41,004,603 D2204E probably damaging Het
Mier3 T A 13: 111,714,850 N427K probably damaging Het
Mmp12 GTAATAATAATAATAATAAT GTAATAATAATAATAAT 9: 7,348,446 probably benign Het
Mroh3 T A 1: 136,186,123 M643L probably benign Het
Myh11 A G 16: 14,230,800 S548P probably damaging Het
Nat8f6 A C 6: 85,808,523 L215V possibly damaging Het
Nlrp3 G A 11: 59,548,134 R179Q probably damaging Het
Nup88 T C 11: 70,969,671 E94G probably benign Het
Pias1 A T 9: 62,912,766 D306E probably benign Het
Pick1 A G 15: 79,248,895 D385G probably benign Het
Pitx3 A T 19: 46,137,296 probably benign Het
Plpp3 T A 4: 105,194,962 probably null Het
Prlhr C A 19: 60,467,621 R169L probably damaging Het
Ptprf A C 4: 118,210,382 M1872R probably damaging Het
Ptprh T C 7: 4,601,940 D35G probably benign Het
Rnf130 A G 11: 50,085,815 probably null Het
Rnf17 A C 14: 56,505,988 E1337A possibly damaging Het
Sdk2 A G 11: 113,851,882 Y734H probably damaging Het
Slc25a10 C T 11: 120,498,117 T269I probably damaging Het
Slc4a11 A C 2: 130,684,459 V855G probably benign Het
Slc5a5 C A 8: 70,892,330 R111L probably damaging Het
Spg20 A T 3: 55,135,510 M616L probably benign Het
Tmem229a T C 6: 24,954,687 D356G probably damaging Het
Tmem30c A G 16: 57,266,562 S293P probably damaging Het
Tnfrsf14 C A 4: 154,926,598 probably null Het
Tnfrsf19 C T 14: 60,971,178 R298H possibly damaging Het
Ttc21a A G 9: 119,958,792 K809E probably benign Het
Ttn G A 2: 76,750,209 P23447S probably damaging Het
Uap1 T A 1: 170,151,138 probably null Het
Wdr82 A G 9: 106,185,304 Q252R probably benign Het
Zfp523 T C 17: 28,194,993 I34T probably benign Het
Zfp808 T A 13: 62,171,255 H99Q probably damaging Het
Other mutations in Clcnka
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00580:Clcnka APN 4 141391401 nonsense probably null
IGL01420:Clcnka APN 4 141389332 missense probably benign 0.00
IGL01726:Clcnka APN 4 141392740 critical splice donor site probably null
IGL02676:Clcnka APN 4 141392783 missense probably damaging 0.97
IGL02983:Clcnka APN 4 141390131 missense probably damaging 0.99
IGL03182:Clcnka APN 4 141394487 missense probably damaging 1.00
free_trade UTSW 4 141395158 nonsense probably null
R0646:Clcnka UTSW 4 141396606 missense probably benign
R1292:Clcnka UTSW 4 141395592 splice site probably benign
R1479:Clcnka UTSW 4 141389447 missense possibly damaging 0.82
R1864:Clcnka UTSW 4 141392802 missense probably damaging 0.99
R3806:Clcnka UTSW 4 141387290 missense probably null 0.05
R5035:Clcnka UTSW 4 141395158 nonsense probably null
R5617:Clcnka UTSW 4 141389317 missense probably null 0.01
R6048:Clcnka UTSW 4 141394487 missense probably damaging 1.00
R7042:Clcnka UTSW 4 141391380 missense probably damaging 0.97
R7068:Clcnka UTSW 4 141387110 missense probably damaging 0.99
R8016:Clcnka UTSW 4 141390152 missense possibly damaging 0.85
R8292:Clcnka UTSW 4 141397961 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TTCAAAGAAAGTCTACAGCGATTGG -3'
(R):5'- ATTTCTGCTTATCTGGGCCG -3'

Sequencing Primer
(F):5'- TCTACAGCGATTGGACAGC -3'
(R):5'- TTATCTGGGCCGCGTGC -3'
Posted On2017-02-10