Incidental Mutation 'R5869:Tnfrsf14'
ID 454319
Institutional Source Beutler Lab
Gene Symbol Tnfrsf14
Ensembl Gene ENSMUSG00000042333
Gene Name tumor necrosis factor receptor superfamily, member 14 (herpesvirus entry mediator)
Synonyms Atar, Hvem, HveA
MMRRC Submission 044077-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.055) question?
Stock # R5869 (G1)
Quality Score 167
Status Validated
Chromosome 4
Chromosomal Location 154921933-154928563 bp(-) (GRCm38)
Type of Mutation critical splice donor site (1 bp from exon)
DNA Base Change (assembly) C to A at 154926598 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000151575 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000123514] [ENSMUST00000137803] [ENSMUST00000145296] [ENSMUST00000152687] [ENSMUST00000219534]
AlphaFold Q80WM9
Predicted Effect probably null
Transcript: ENSMUST00000045919
SMART Domains Protein: ENSMUSP00000045240
Gene: ENSMUSG00000042333

DomainStartEndE-ValueType
signal peptide 1 38 N/A INTRINSIC
TNFR 42 75 1.19e-2 SMART
TNFR 78 119 1.61e-8 SMART
TNFR 121 162 2.49e-5 SMART
TNFR 165 203 2.63e-4 SMART
transmembrane domain 208 230 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000123514
SMART Domains Protein: ENSMUSP00000116757
Gene: ENSMUSG00000042333

DomainStartEndE-ValueType
signal peptide 1 38 N/A INTRINSIC
TNFR 42 75 1.19e-2 SMART
TNFR 78 119 1.61e-8 SMART
TNFR 121 162 2.49e-5 SMART
TNFR 165 203 2.63e-4 SMART
transmembrane domain 208 230 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000137803
Predicted Effect probably benign
Transcript: ENSMUST00000145296
Predicted Effect probably benign
Transcript: ENSMUST00000152687
SMART Domains Protein: ENSMUSP00000117890
Gene: ENSMUSG00000042333

DomainStartEndE-ValueType
TNFR 37 78 2.49e-5 SMART
TNFR 81 119 2.63e-4 SMART
transmembrane domain 123 145 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000219534
Meta Mutation Damage Score 0.9487 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.1%
Validation Efficiency 93% (68/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the TNF (tumor necrosis factor) receptor superfamily. The encoded protein functions in signal transduction pathways that activate inflammatory and inhibitory T-cell immune response. It binds herpes simplex virus (HSV) viral envelope glycoprotein D (gD), mediating its entry into cells. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Homozygotes for a null allele are less susceptible to induced colitis. Homozygotes for a second null allele exhibit enhanced responses to various T cell stimuli and are more susceptible to developing autoimmune diseases. Homozygotes for a third null allele show reduced length of allograft survival. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adarb1 T C 10: 77,325,616 probably benign Het
Arsk T C 13: 76,091,784 E100G probably benign Het
Ascc3 C T 10: 50,842,183 R1991* probably null Het
Aspscr1 T C 11: 120,688,920 I31T possibly damaging Het
Asz1 T C 6: 18,074,940 probably benign Het
Calm5 T A 13: 3,854,321 probably benign Het
Car5a G A 8: 121,916,380 T295I probably benign Het
Ccdc174 T A 6: 91,885,418 probably benign Het
Celsr2 G A 3: 108,413,909 A529V probably damaging Het
Cep192 A G 18: 67,815,864 D252G probably benign Het
Clcnka A G 4: 141,394,965 F217L probably benign Het
Cnot3 A T 7: 3,644,930 probably benign Het
Coro1c A G 5: 113,850,846 probably benign Het
Cstf3 A G 2: 104,659,240 probably null Het
Dcdc2a C T 13: 25,107,730 P233S probably benign Het
Ddx55 A G 5: 124,568,682 T581A probably benign Het
Exo1 T C 1: 175,901,283 S638P possibly damaging Het
Fam135a T C 1: 24,029,430 E616G possibly damaging Het
Fignl2 T C 15: 101,053,280 S374G unknown Het
Gm4799 A T 10: 82,954,449 noncoding transcript Het
Hectd4 T C 5: 121,343,225 probably null Het
Ighv1-76 T C 12: 115,848,038 E65G probably damaging Het
Igsf9b C A 9: 27,323,235 H465Q probably benign Het
Itga9 A G 9: 118,663,889 D284G probably damaging Het
Itpr1 T C 6: 108,473,529 S1940P probably benign Het
Kcnb1 A G 2: 167,188,071 S185P probably benign Het
Kif20a G A 18: 34,632,415 A822T probably benign Het
Krt1 A T 15: 101,850,131 F199L probably damaging Het
Lpin2 A G 17: 71,232,276 probably benign Het
Lrp1b A C 2: 41,004,603 D2204E probably damaging Het
Mier3 T A 13: 111,714,850 N427K probably damaging Het
Mmp12 GTAATAATAATAATAATAAT GTAATAATAATAATAAT 9: 7,348,446 probably benign Het
Mroh3 T A 1: 136,186,123 M643L probably benign Het
Myh11 A G 16: 14,230,800 S548P probably damaging Het
Nat8f6 A C 6: 85,808,523 L215V possibly damaging Het
Nlrp3 G A 11: 59,548,134 R179Q probably damaging Het
Nup88 T C 11: 70,969,671 E94G probably benign Het
Pias1 A T 9: 62,912,766 D306E probably benign Het
Pick1 A G 15: 79,248,895 D385G probably benign Het
Pitx3 A T 19: 46,137,296 probably benign Het
Plpp3 T A 4: 105,194,962 probably null Het
Prlhr C A 19: 60,467,621 R169L probably damaging Het
Ptprf A C 4: 118,210,382 M1872R probably damaging Het
Ptprh T C 7: 4,601,940 D35G probably benign Het
Rnf130 A G 11: 50,085,815 probably null Het
Rnf17 A C 14: 56,505,988 E1337A possibly damaging Het
Sdk2 A G 11: 113,851,882 Y734H probably damaging Het
Slc25a10 C T 11: 120,498,117 T269I probably damaging Het
Slc4a11 A C 2: 130,684,459 V855G probably benign Het
Slc5a5 C A 8: 70,892,330 R111L probably damaging Het
Spg20 A T 3: 55,135,510 M616L probably benign Het
Tmem229a T C 6: 24,954,687 D356G probably damaging Het
Tmem30c A G 16: 57,266,562 S293P probably damaging Het
Tnfrsf19 C T 14: 60,971,178 R298H possibly damaging Het
Ttc21a A G 9: 119,958,792 K809E probably benign Het
Ttn G A 2: 76,750,209 P23447S probably damaging Het
Uap1 T A 1: 170,151,138 probably null Het
Wdr82 A G 9: 106,185,304 Q252R probably benign Het
Zfp523 T C 17: 28,194,993 I34T probably benign Het
Zfp808 T A 13: 62,171,255 H99Q probably damaging Het
Other mutations in Tnfrsf14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02680:Tnfrsf14 APN 4 154924470 nonsense probably null
che UTSW 4 154925380 nonsense probably null
fidel UTSW 4 154926661 missense probably damaging 1.00
trotter UTSW 4 154926598 critical splice donor site probably null
R0271:Tnfrsf14 UTSW 4 154926597 critical splice donor site probably null
R0605:Tnfrsf14 UTSW 4 154925380 nonsense probably null
R1738:Tnfrsf14 UTSW 4 154925331 missense probably damaging 1.00
R1756:Tnfrsf14 UTSW 4 154925322 missense possibly damaging 0.90
R5371:Tnfrsf14 UTSW 4 154922477 splice site probably null
R6113:Tnfrsf14 UTSW 4 154924492 missense possibly damaging 0.64
R7790:Tnfrsf14 UTSW 4 154923293 missense probably benign 0.00
R8015:Tnfrsf14 UTSW 4 154926661 missense probably damaging 1.00
R8354:Tnfrsf14 UTSW 4 154926655 missense possibly damaging 0.91
R8454:Tnfrsf14 UTSW 4 154926655 missense possibly damaging 0.91
R8738:Tnfrsf14 UTSW 4 154923253 missense possibly damaging 0.60
Predicted Primers PCR Primer
(F):5'- AGCAGGCAATAGAATCTCAGTG -3'
(R):5'- ACTTGCTAGACCCATGTGAGG -3'

Sequencing Primer
(F):5'- CAATAGAATCTCAGTGATGGGGATG -3'
(R):5'- GAAGGTTTCTGTGGATTAACCCCC -3'
Posted On 2017-02-10