Incidental Mutation 'R5869:Tmem229a'
ID454323
Institutional Source Beutler Lab
Gene Symbol Tmem229a
Ensembl Gene ENSMUSG00000048022
Gene Nametransmembrane protein 229A
Synonyms
MMRRC Submission 044077-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R5869 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location24951141-24956297 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 24954687 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 356 (D356G)
Ref Sequence ENSEMBL: ENSMUSP00000116234 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000127247]
Predicted Effect probably damaging
Transcript: ENSMUST00000127247
AA Change: D356G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000116234
Gene: ENSMUSG00000048022
AA Change: D356G

DomainStartEndE-ValueType
low complexity region 31 47 N/A INTRINSIC
internal_repeat_1 51 108 1.6e-5 PROSPERO
low complexity region 139 163 N/A INTRINSIC
low complexity region 208 220 N/A INTRINSIC
internal_repeat_1 229 286 1.6e-5 PROSPERO
transmembrane domain 301 319 N/A INTRINSIC
transmembrane domain 332 354 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.1%
Validation Efficiency 93% (68/73)
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adarb1 T C 10: 77,325,616 probably benign Het
Arsk T C 13: 76,091,784 E100G probably benign Het
Ascc3 C T 10: 50,842,183 R1991* probably null Het
Aspscr1 T C 11: 120,688,920 I31T possibly damaging Het
Asz1 T C 6: 18,074,940 probably benign Het
Calm5 T A 13: 3,854,321 probably benign Het
Car5a G A 8: 121,916,380 T295I probably benign Het
Ccdc174 T A 6: 91,885,418 probably benign Het
Celsr2 G A 3: 108,413,909 A529V probably damaging Het
Cep192 A G 18: 67,815,864 D252G probably benign Het
Clcnka A G 4: 141,394,965 F217L probably benign Het
Cnot3 A T 7: 3,644,930 probably benign Het
Coro1c A G 5: 113,850,846 probably benign Het
Cstf3 A G 2: 104,659,240 probably null Het
Dcdc2a C T 13: 25,107,730 P233S probably benign Het
Ddx55 A G 5: 124,568,682 T581A probably benign Het
Exo1 T C 1: 175,901,283 S638P possibly damaging Het
Fam135a T C 1: 24,029,430 E616G possibly damaging Het
Fignl2 T C 15: 101,053,280 S374G unknown Het
Gm4799 A T 10: 82,954,449 noncoding transcript Het
Hectd4 T C 5: 121,343,225 probably null Het
Ighv1-76 T C 12: 115,848,038 E65G probably damaging Het
Igsf9b C A 9: 27,323,235 H465Q probably benign Het
Itga9 A G 9: 118,663,889 D284G probably damaging Het
Itpr1 T C 6: 108,473,529 S1940P probably benign Het
Kcnb1 A G 2: 167,188,071 S185P probably benign Het
Kif20a G A 18: 34,632,415 A822T probably benign Het
Krt1 A T 15: 101,850,131 F199L probably damaging Het
Lpin2 A G 17: 71,232,276 probably benign Het
Lrp1b A C 2: 41,004,603 D2204E probably damaging Het
Mier3 T A 13: 111,714,850 N427K probably damaging Het
Mmp12 GTAATAATAATAATAATAAT GTAATAATAATAATAAT 9: 7,348,446 probably benign Het
Mroh3 T A 1: 136,186,123 M643L probably benign Het
Myh11 A G 16: 14,230,800 S548P probably damaging Het
Nat8f6 A C 6: 85,808,523 L215V possibly damaging Het
Nlrp3 G A 11: 59,548,134 R179Q probably damaging Het
Nup88 T C 11: 70,969,671 E94G probably benign Het
Pias1 A T 9: 62,912,766 D306E probably benign Het
Pick1 A G 15: 79,248,895 D385G probably benign Het
Pitx3 A T 19: 46,137,296 probably benign Het
Plpp3 T A 4: 105,194,962 probably null Het
Prlhr C A 19: 60,467,621 R169L probably damaging Het
Ptprf A C 4: 118,210,382 M1872R probably damaging Het
Ptprh T C 7: 4,601,940 D35G probably benign Het
Rnf130 A G 11: 50,085,815 probably null Het
Rnf17 A C 14: 56,505,988 E1337A possibly damaging Het
Sdk2 A G 11: 113,851,882 Y734H probably damaging Het
Slc25a10 C T 11: 120,498,117 T269I probably damaging Het
Slc4a11 A C 2: 130,684,459 V855G probably benign Het
Slc5a5 C A 8: 70,892,330 R111L probably damaging Het
Spg20 A T 3: 55,135,510 M616L probably benign Het
Tmem30c A G 16: 57,266,562 S293P probably damaging Het
Tnfrsf14 C A 4: 154,926,598 probably null Het
Tnfrsf19 C T 14: 60,971,178 R298H possibly damaging Het
Ttc21a A G 9: 119,958,792 K809E probably benign Het
Ttn G A 2: 76,750,209 P23447S probably damaging Het
Uap1 T A 1: 170,151,138 probably null Het
Wdr82 A G 9: 106,185,304 Q252R probably benign Het
Zfp523 T C 17: 28,194,993 I34T probably benign Het
Zfp808 T A 13: 62,171,255 H99Q probably damaging Het
Other mutations in Tmem229a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02239:Tmem229a APN 6 24955540 missense probably damaging 1.00
IGL02801:Tmem229a APN 6 24955122 missense probably benign 0.09
R0077:Tmem229a UTSW 6 24955702 missense probably benign
R1932:Tmem229a UTSW 6 24955011 missense probably damaging 1.00
R2016:Tmem229a UTSW 6 24955062 missense probably benign 0.00
R3522:Tmem229a UTSW 6 24955059 missense probably benign 0.01
R4229:Tmem229a UTSW 6 24954832 missense probably damaging 1.00
R4230:Tmem229a UTSW 6 24954832 missense probably damaging 1.00
R5610:Tmem229a UTSW 6 24955581 missense probably damaging 1.00
R5836:Tmem229a UTSW 6 24955017 missense probably damaging 1.00
R5878:Tmem229a UTSW 6 24955173 missense probably benign
R6505:Tmem229a UTSW 6 24954921 missense probably damaging 1.00
R6915:Tmem229a UTSW 6 24954658 missense probably benign 0.19
R7442:Tmem229a UTSW 6 24955690 missense probably damaging 1.00
R7692:Tmem229a UTSW 6 24955212 missense probably benign 0.19
R8252:Tmem229a UTSW 6 24955581 missense probably damaging 1.00
Z1176:Tmem229a UTSW 6 24954881 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCACATATTGGCAGAGTTTGG -3'
(R):5'- CTTCTTCAATGTGCTGGGGC -3'

Sequencing Primer
(F):5'- CACATATTGGCAGAGTTTGGTAAAG -3'
(R):5'- CGTGGTGGAAAAACTCTACTTCC -3'
Posted On2017-02-10