Incidental Mutation 'R0555:Nol4l'
ID 45433
Institutional Source Beutler Lab
Gene Symbol Nol4l
Ensembl Gene ENSMUSG00000061411
Gene Name nucleolar protein 4-like
Synonyms 8430427H17Rik, LOC381396
MMRRC Submission 038747-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.906) question?
Stock # R0555 (G1)
Quality Score 189
Status Validated
Chromosome 2
Chromosomal Location 153249381-153371869 bp(-) (GRCm39)
Type of Mutation splice site (4 bp from exon)
DNA Base Change (assembly) T to C at 153259604 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000105407 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035346] [ENSMUST00000035346] [ENSMUST00000109784] [ENSMUST00000109784]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000035346
SMART Domains Protein: ENSMUSP00000036571
Gene: ENSMUSG00000061411

DomainStartEndE-ValueType
low complexity region 58 71 N/A INTRINSIC
low complexity region 277 305 N/A INTRINSIC
low complexity region 405 422 N/A INTRINSIC
low complexity region 619 639 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000035346
SMART Domains Protein: ENSMUSP00000036571
Gene: ENSMUSG00000061411

DomainStartEndE-ValueType
low complexity region 58 71 N/A INTRINSIC
low complexity region 277 305 N/A INTRINSIC
low complexity region 405 422 N/A INTRINSIC
low complexity region 619 639 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000109784
SMART Domains Protein: ENSMUSP00000105407
Gene: ENSMUSG00000061411

DomainStartEndE-ValueType
low complexity region 33 61 N/A INTRINSIC
SCOP:d1sig__ 161 246 1e-2 SMART
low complexity region 375 395 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000109784
SMART Domains Protein: ENSMUSP00000105407
Gene: ENSMUSG00000061411

DomainStartEndE-ValueType
low complexity region 33 61 N/A INTRINSIC
SCOP:d1sig__ 161 246 1e-2 SMART
low complexity region 375 395 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000119815
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132770
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.8%
  • 10x: 96.9%
  • 20x: 93.8%
Validation Efficiency 100% (98/98)
Allele List at MGI
Other mutations in this stock
Total: 96 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam10 T A 9: 70,661,516 (GRCm39) I363N probably damaging Het
Ahcyl2 T C 6: 29,890,670 (GRCm39) probably benign Het
Asap1 A G 15: 63,966,213 (GRCm39) L941P probably damaging Het
Aurka G A 2: 172,209,067 (GRCm39) R23C probably benign Het
Cacna1c C T 6: 118,589,586 (GRCm39) R1446H probably damaging Het
Casp8ap2 T A 4: 32,640,381 (GRCm39) H478Q probably damaging Het
Clcn4 C T 7: 7,293,503 (GRCm39) A418T possibly damaging Het
Cplx3 T C 9: 57,521,384 (GRCm39) T193A probably benign Het
Cpxm2 A T 7: 131,645,772 (GRCm39) Y715* probably null Het
Csmd1 T C 8: 16,235,287 (GRCm39) M1179V probably benign Het
Ddx21 A T 10: 62,423,307 (GRCm39) F632I probably damaging Het
Dnai1 C A 4: 41,625,335 (GRCm39) T433K possibly damaging Het
Dpyd G A 3: 119,225,191 (GRCm39) G988D probably damaging Het
Dync1i2 AAAAGAAGAGGAAAGAAGAGGAAAG AAAAGAAGAGGAAAG 2: 71,044,862 (GRCm39) probably null Het
Dync1li2 A T 8: 105,147,297 (GRCm39) S466T probably benign Het
Ears2 T C 7: 121,647,667 (GRCm39) T206A probably benign Het
Elmod1 A T 9: 53,838,876 (GRCm39) probably benign Het
Eps8l3 C A 3: 107,799,661 (GRCm39) D590E probably benign Het
Etfdh A T 3: 79,513,112 (GRCm39) H370Q probably benign Het
Fam83g C A 11: 61,598,489 (GRCm39) A792E probably benign Het
Ffar3 G T 7: 30,554,962 (GRCm39) Y119* probably null Het
Fosb G T 7: 19,041,138 (GRCm39) S118R possibly damaging Het
Foxn4 G A 5: 114,401,175 (GRCm39) L3F probably damaging Het
Foxo4 A G X: 100,298,784 (GRCm39) K65E probably damaging Het
Frem2 A G 3: 53,424,281 (GRCm39) L3052P probably damaging Het
Fubp3 G A 2: 31,498,149 (GRCm39) R101H probably damaging Het
Gba2 C A 4: 43,569,927 (GRCm39) G429C probably damaging Het
Gimap1 T C 6: 48,718,363 (GRCm39) probably benign Het
Gnas A G 2: 174,140,304 (GRCm39) T158A possibly damaging Het
Gpc5 T C 14: 115,789,740 (GRCm39) V538A probably damaging Het
Greb1l T C 18: 10,458,781 (GRCm39) probably benign Het
H2-M10.5 G A 17: 37,085,620 (GRCm39) G260R probably damaging Het
Hbs1l A C 10: 21,225,222 (GRCm39) Q412H probably benign Het
Hecw1 G T 13: 14,411,526 (GRCm39) T1058N probably damaging Het
Heph A T X: 95,601,690 (GRCm39) T1027S probably damaging Het
Hoga1 A C 19: 42,034,514 (GRCm39) E53A possibly damaging Het
Insrr T G 3: 87,721,744 (GRCm39) probably benign Het
Ipo11 A T 13: 107,028,969 (GRCm39) V328D probably damaging Het
Jakmip1 T C 5: 37,276,217 (GRCm39) V509A probably damaging Het
Jmjd1c T C 10: 67,061,568 (GRCm39) V1307A probably benign Het
Kmt2a T A 9: 44,758,868 (GRCm39) S1027C probably damaging Het
Kprp G C 3: 92,731,664 (GRCm39) P462R unknown Het
Lrit3 A T 3: 129,584,945 (GRCm39) V271D probably damaging Het
Map4 T A 9: 109,808,171 (GRCm39) probably benign Het
Mark4 A C 7: 19,182,598 (GRCm39) probably benign Het
Mfsd14b A G 13: 65,226,259 (GRCm39) V142A probably benign Het
Mis18bp1 A T 12: 65,208,227 (GRCm39) I162N possibly damaging Het
Mrpl43 A T 19: 44,994,391 (GRCm39) probably benign Het
Mrpl47 A G 3: 32,790,842 (GRCm39) F16S probably benign Het
Myh2 G T 11: 67,069,793 (GRCm39) G380C probably damaging Het
Myo15a T C 11: 60,412,464 (GRCm39) Y3284H probably damaging Het
Nectin2 A G 7: 19,467,148 (GRCm39) probably benign Het
Neu3 A G 7: 99,463,390 (GRCm39) V111A probably damaging Het
Nphp3 C A 9: 103,900,633 (GRCm39) H510Q probably damaging Het
Nprl3 T A 11: 32,183,118 (GRCm39) probably null Het
Or14c39 A G 7: 86,344,516 (GRCm39) N284S probably damaging Het
Or4c58 T C 2: 89,674,787 (GRCm39) T177A probably benign Het
Or52ab7 T C 7: 102,978,170 (GRCm39) V159A probably benign Het
Or6c2 T C 10: 129,362,765 (GRCm39) I223T possibly damaging Het
Pex1 A G 5: 3,656,130 (GRCm39) E319G possibly damaging Het
Pgap6 T C 17: 26,336,088 (GRCm39) L130S probably benign Het
Phtf1 C A 3: 103,911,785 (GRCm39) T709K probably damaging Het
Plek2 A T 12: 78,938,946 (GRCm39) L271Q probably damaging Het
Plekhg5 T A 4: 152,191,926 (GRCm39) C421* probably null Het
Polk A C 13: 96,620,687 (GRCm39) C525W probably damaging Het
Ppfibp2 T C 7: 107,328,381 (GRCm39) S471P probably damaging Het
Prickle2 A T 6: 92,435,546 (GRCm39) F74L probably benign Het
Prl7d1 A T 13: 27,896,038 (GRCm39) V113D probably benign Het
Prr14 C T 7: 127,071,267 (GRCm39) probably benign Het
Ptpro T A 6: 137,420,592 (GRCm39) V1007D probably damaging Het
Ret A G 6: 118,155,571 (GRCm39) V375A probably damaging Het
Rora T C 9: 69,269,028 (GRCm39) F41S probably damaging Het
Sall1 T C 8: 89,758,386 (GRCm39) T573A probably benign Het
Shb A G 4: 45,458,321 (GRCm39) V281A possibly damaging Het
Slc25a26 A T 6: 94,569,391 (GRCm39) probably null Het
Sltm T C 9: 70,493,363 (GRCm39) F769L probably damaging Het
Snx9 T A 17: 5,968,688 (GRCm39) M328K probably damaging Het
Stk25 G T 1: 93,552,313 (GRCm39) Q356K probably benign Het
Svep1 T A 4: 58,128,858 (GRCm39) Y613F possibly damaging Het
Syne4 G A 7: 30,016,169 (GRCm39) A195T probably damaging Het
Tmem217b A T 17: 29,738,545 (GRCm39) F74I probably benign Het
Trcg1 C T 9: 57,149,616 (GRCm39) T396M probably damaging Het
Trim30b A G 7: 104,006,505 (GRCm39) V117A possibly damaging Het
Trpc4 T C 3: 54,209,511 (GRCm39) probably benign Het
Ttll4 A G 1: 74,727,439 (GRCm39) H827R probably damaging Het
Tut7 A G 13: 59,948,131 (GRCm39) V328A probably benign Het
Urgcp T C 11: 5,667,477 (GRCm39) E287G probably damaging Het
Usp2 G T 9: 44,004,081 (GRCm39) L319F probably damaging Het
Vmn1r167 A T 7: 23,204,512 (GRCm39) V168D probably damaging Het
Vmn2r100 C A 17: 19,742,382 (GRCm39) P252Q possibly damaging Het
Vmn2r61 A T 7: 41,915,442 (GRCm39) I130F probably benign Het
Vmn2r63 A T 7: 42,577,952 (GRCm39) Y195* probably null Het
Vmn2r81 T C 10: 79,129,283 (GRCm39) S725P probably damaging Het
Wnt10b A G 15: 98,670,818 (GRCm39) probably benign Het
Zfp292 T C 4: 34,807,194 (GRCm39) E1950G probably damaging Het
Zfyve16 A G 13: 92,653,028 (GRCm39) probably benign Het
Other mutations in Nol4l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00933:Nol4l APN 2 153,319,856 (GRCm39) missense probably damaging 0.96
IGL01325:Nol4l APN 2 153,278,271 (GRCm39) splice site probably benign
IGL02608:Nol4l APN 2 153,278,213 (GRCm39) missense possibly damaging 0.50
IGL02886:Nol4l APN 2 153,371,457 (GRCm39) missense probably benign 0.27
IGL03210:Nol4l APN 2 153,371,378 (GRCm39) missense probably benign 0.03
IGL03055:Nol4l UTSW 2 153,278,190 (GRCm39) synonymous silent
R0285:Nol4l UTSW 2 153,325,773 (GRCm39) splice site probably benign
R0345:Nol4l UTSW 2 153,253,672 (GRCm39) missense probably benign 0.00
R1966:Nol4l UTSW 2 153,371,375 (GRCm39) missense probably benign 0.01
R2044:Nol4l UTSW 2 153,371,441 (GRCm39) missense possibly damaging 0.66
R2368:Nol4l UTSW 2 153,259,959 (GRCm39) missense probably damaging 1.00
R4855:Nol4l UTSW 2 153,253,726 (GRCm39) missense probably benign 0.06
R5696:Nol4l UTSW 2 153,260,026 (GRCm39) missense probably damaging 0.99
R5776:Nol4l UTSW 2 153,259,741 (GRCm39) missense probably damaging 1.00
R6807:Nol4l UTSW 2 153,325,746 (GRCm39) nonsense probably null
R6845:Nol4l UTSW 2 153,258,582 (GRCm39) missense probably benign 0.00
R6872:Nol4l UTSW 2 153,325,737 (GRCm39) missense probably damaging 0.98
R6940:Nol4l UTSW 2 153,253,684 (GRCm39) missense probably benign 0.00
R8165:Nol4l UTSW 2 153,262,473 (GRCm39) nonsense probably null
R8263:Nol4l UTSW 2 153,259,337 (GRCm39) missense probably damaging 0.99
R8500:Nol4l UTSW 2 153,278,266 (GRCm39) missense probably damaging 0.99
R8938:Nol4l UTSW 2 153,262,651 (GRCm39) missense probably damaging 1.00
R9097:Nol4l UTSW 2 153,312,630 (GRCm39) missense probably damaging 0.96
R9098:Nol4l UTSW 2 153,312,630 (GRCm39) missense probably damaging 0.96
R9099:Nol4l UTSW 2 153,312,630 (GRCm39) missense probably damaging 0.96
R9115:Nol4l UTSW 2 153,253,638 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGAGCGCATACTTGTGAGGACTG -3'
(R):5'- CGATGACCATGATGACCATGAGGAC -3'

Sequencing Primer
(F):5'- AGGACTGGTAGATCTCCAGGC -3'
(R):5'- tgatgaccatgaggacaatgac -3'
Posted On 2013-06-11