Incidental Mutation 'R5869:Car5a'
ID454330
Institutional Source Beutler Lab
Gene Symbol Car5a
Ensembl Gene ENSMUSG00000025317
Gene Namecarbonic anhydrase 5a, mitochondrial
SynonymsCar5
MMRRC Submission 044077-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.140) question?
Stock #R5869 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location121916126-121944904 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 121916380 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 295 (T295I)
Ref Sequence ENSEMBL: ENSMUSP00000060457 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057653] [ENSMUST00000127664]
PDB Structure
MURINE MITOCHONDRIAL CARBONIC ANYHDRASE V AT 2.45 ANGSTROMS RESOLUTION [X-RAY DIFFRACTION]
COMPLEX BETWEEN MURINE MITOCHONDRIAL CARBONIC ANYHDRASE V AND THE TRANSITION STATE ANALOGUE ACETAZOLAMIDE [X-RAY DIFFRACTION]
Crystal Structure of F65A/Y131C Carbonic Anhydrase V, covalently modified with 4-chloromethylimidazole [X-RAY DIFFRACTION]
MURINE CARBONIC ANHYDRASE V [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000057653
AA Change: T295I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000060457
Gene: ENSMUSG00000025317
AA Change: T295I

DomainStartEndE-ValueType
Carb_anhydrase 27 290 6.61e-125 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140928
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151462
Meta Mutation Damage Score 0.0636 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.1%
Validation Efficiency 93% (68/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Carbonic anhydrases (CAs) are a large family of zinc metalloenzymes that catalyze the reversible hydration of carbon dioxide. They participate in a variety of biological processes, including respiration, calcification, acid-base balance, bone resorption, and the formation of aqueous humor, cerebrospinal fluid, saliva, and gastric acid. They show extensive diversity in tissue distribution and in their subcellular localization. CA VA is localized in the mitochondria and expressed primarily in the liver. It may play an important role in ureagenesis and gluconeogenesis. CA5A gene maps to chromosome 16q24.3 and an unprocessed pseudogene has been assigned to 16p12-p11.2. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased body size, hyperammonemia, and increased levels of urinary metabolites. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adarb1 T C 10: 77,325,616 probably benign Het
Arsk T C 13: 76,091,784 E100G probably benign Het
Ascc3 C T 10: 50,842,183 R1991* probably null Het
Aspscr1 T C 11: 120,688,920 I31T possibly damaging Het
Asz1 T C 6: 18,074,940 probably benign Het
Calm5 T A 13: 3,854,321 probably benign Het
Ccdc174 T A 6: 91,885,418 probably benign Het
Celsr2 G A 3: 108,413,909 A529V probably damaging Het
Cep192 A G 18: 67,815,864 D252G probably benign Het
Clcnka A G 4: 141,394,965 F217L probably benign Het
Cnot3 A T 7: 3,644,930 probably benign Het
Coro1c A G 5: 113,850,846 probably benign Het
Cstf3 A G 2: 104,659,240 probably null Het
Dcdc2a C T 13: 25,107,730 P233S probably benign Het
Ddx55 A G 5: 124,568,682 T581A probably benign Het
Exo1 T C 1: 175,901,283 S638P possibly damaging Het
Fam135a T C 1: 24,029,430 E616G possibly damaging Het
Fignl2 T C 15: 101,053,280 S374G unknown Het
Gm4799 A T 10: 82,954,449 noncoding transcript Het
Hectd4 T C 5: 121,343,225 probably null Het
Ighv1-76 T C 12: 115,848,038 E65G probably damaging Het
Igsf9b C A 9: 27,323,235 H465Q probably benign Het
Itga9 A G 9: 118,663,889 D284G probably damaging Het
Itpr1 T C 6: 108,473,529 S1940P probably benign Het
Kcnb1 A G 2: 167,188,071 S185P probably benign Het
Kif20a G A 18: 34,632,415 A822T probably benign Het
Krt1 A T 15: 101,850,131 F199L probably damaging Het
Lpin2 A G 17: 71,232,276 probably benign Het
Lrp1b A C 2: 41,004,603 D2204E probably damaging Het
Mier3 T A 13: 111,714,850 N427K probably damaging Het
Mmp12 GTAATAATAATAATAATAAT GTAATAATAATAATAAT 9: 7,348,446 probably benign Het
Mroh3 T A 1: 136,186,123 M643L probably benign Het
Myh11 A G 16: 14,230,800 S548P probably damaging Het
Nat8f6 A C 6: 85,808,523 L215V possibly damaging Het
Nlrp3 G A 11: 59,548,134 R179Q probably damaging Het
Nup88 T C 11: 70,969,671 E94G probably benign Het
Pias1 A T 9: 62,912,766 D306E probably benign Het
Pick1 A G 15: 79,248,895 D385G probably benign Het
Pitx3 A T 19: 46,137,296 probably benign Het
Plpp3 T A 4: 105,194,962 probably null Het
Prlhr C A 19: 60,467,621 R169L probably damaging Het
Ptprf A C 4: 118,210,382 M1872R probably damaging Het
Ptprh T C 7: 4,601,940 D35G probably benign Het
Rnf130 A G 11: 50,085,815 probably null Het
Rnf17 A C 14: 56,505,988 E1337A possibly damaging Het
Sdk2 A G 11: 113,851,882 Y734H probably damaging Het
Slc25a10 C T 11: 120,498,117 T269I probably damaging Het
Slc4a11 A C 2: 130,684,459 V855G probably benign Het
Slc5a5 C A 8: 70,892,330 R111L probably damaging Het
Spg20 A T 3: 55,135,510 M616L probably benign Het
Tmem229a T C 6: 24,954,687 D356G probably damaging Het
Tmem30c A G 16: 57,266,562 S293P probably damaging Het
Tnfrsf14 C A 4: 154,926,598 probably null Het
Tnfrsf19 C T 14: 60,971,178 R298H possibly damaging Het
Ttc21a A G 9: 119,958,792 K809E probably benign Het
Ttn G A 2: 76,750,209 P23447S probably damaging Het
Uap1 T A 1: 170,151,138 probably null Het
Wdr82 A G 9: 106,185,304 Q252R probably benign Het
Zfp523 T C 17: 28,194,993 I34T probably benign Het
Zfp808 T A 13: 62,171,255 H99Q probably damaging Het
Other mutations in Car5a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01890:Car5a APN 8 121923610 missense probably benign 0.07
IGL01972:Car5a APN 8 121927082 critical splice donor site probably null
R0152:Car5a UTSW 8 121916446 missense probably damaging 1.00
R0562:Car5a UTSW 8 121944730 missense probably benign 0.00
R0699:Car5a UTSW 8 121944816 unclassified probably benign
R1827:Car5a UTSW 8 121923808 missense probably benign 0.00
R2274:Car5a UTSW 8 121944669 critical splice donor site probably null
R4261:Car5a UTSW 8 121944749 missense probably benign 0.03
R5436:Car5a UTSW 8 121917242 intron probably benign
R5937:Car5a UTSW 8 121939821 missense probably damaging 1.00
R6388:Car5a UTSW 8 121927171 missense probably damaging 1.00
R6803:Car5a UTSW 8 121923765 critical splice donor site probably null
R7369:Car5a UTSW 8 121923834 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GCTCGGGTTTCTTTAAAGAATATCTC -3'
(R):5'- TGTGCCTGTGTCAGCTCAC -3'

Sequencing Primer
(F):5'- TGGAACTCACTCTGTAGACCAGG -3'
(R):5'- TGTGTCAGCTCACCGCGG -3'
Posted On2017-02-10