Mutagenetix > Incidental Mutations

Incidental Mutation 'R5869:Igsf9b'

454331

Institutional Source

Beutler Lab

Gene Symbol

Igsf9b

Ensembl Gene

ENSMUSG00000034275

Gene Name

immunoglobulin superfamily, member 9B

Synonyms

LOC235086

MMRRC Submission

044077-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.460) question?

Stock #

R5869 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

27299204-27357546 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 27323235 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Glutamine at position 465 (H465Q)

Ref Sequence

ENSEMBL: ENSMUSP00000149356 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000115247] [ENSMUST00000133213] [ENSMUST00000214357]

AlphaFold

E9PZ19

Predicted Effect

probably benign
Transcript: ENSMUST00000115247
AA Change: H465Q

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)

SMART Domains

Protein: ENSMUSP00000110902
Gene: ENSMUSG00000034275
AA Change: H465Q

Domain	Start	End	E-Value	Type
signal peptide	1	17	N/A	INTRINSIC
IG	30	134	9.41e-9	SMART
IGc2	152	215	1.82e-15	SMART
FN3	232	302	7.02e1	SMART
IGc2	241	310	3.01e-7	SMART
IG	331	417	2.79e-2	SMART
IGc2	433	495	5.48e-10	SMART
FN3	510	591	1.35e-7	SMART
FN3	615	695	3.08e-2	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000133213
AA Change: H465Q

PolyPhen 2 Score 0.334 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000117017
Gene: ENSMUSG00000034275
AA Change: H465Q

Domain	Start	End	E-Value	Type
signal peptide	1	17	N/A	INTRINSIC
IG	30	134	9.41e-9	SMART
IGc2	152	215	1.82e-15	SMART
FN3	232	302	7.02e1	SMART
IGc2	241	310	3.01e-7	SMART
IG	331	417	2.79e-2	SMART
IGc2	433	495	5.48e-10	SMART
FN3	510	591	1.35e-7	SMART
FN3	615	695	3.08e-2	SMART
transmembrane domain	727	749	N/A	INTRINSIC
low complexity region	750	760	N/A	INTRINSIC
low complexity region	835	843	N/A	INTRINSIC
low complexity region	971	982	N/A	INTRINSIC
low complexity region	990	1001	N/A	INTRINSIC
low complexity region	1148	1161	N/A	INTRINSIC
low complexity region	1172	1190	N/A	INTRINSIC
low complexity region	1246	1273	N/A	INTRINSIC
low complexity region	1284	1296	N/A	INTRINSIC
low complexity region	1313	1326	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000214187

Predicted Effect

probably benign
Transcript: ENSMUST00000214357
AA Change: H465Q

PolyPhen 2 Score 0.444 (Sensitivity: 0.89; Specificity: 0.90)

Meta Mutation Damage Score

0.0652

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.5%
20x: 92.1%

Validation Efficiency

93% (68/73)

Allele List at MGI

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adarb1	T	C	10: 77,325,616		probably benign	Het
Arsk	T	C	13: 76,091,784	E100G	probably benign	Het
Ascc3	C	T	10: 50,842,183	R1991*	probably null	Het
Aspscr1	T	C	11: 120,688,920	I31T	possibly damaging	Het
Asz1	T	C	6: 18,074,940		probably benign	Het
Calm5	T	A	13: 3,854,321		probably benign	Het
Car5a	G	A	8: 121,916,380	T295I	probably benign	Het
Ccdc174	T	A	6: 91,885,418		probably benign	Het
Celsr2	G	A	3: 108,413,909	A529V	probably damaging	Het
Cep192	A	G	18: 67,815,864	D252G	probably benign	Het
Clcnka	A	G	4: 141,394,965	F217L	probably benign	Het
Cnot3	A	T	7: 3,644,930		probably benign	Het
Coro1c	A	G	5: 113,850,846		probably benign	Het
Cstf3	A	G	2: 104,659,240		probably null	Het
Dcdc2a	C	T	13: 25,107,730	P233S	probably benign	Het
Ddx55	A	G	5: 124,568,682	T581A	probably benign	Het
Exo1	T	C	1: 175,901,283	S638P	possibly damaging	Het
Fam135a	T	C	1: 24,029,430	E616G	possibly damaging	Het
Fignl2	T	C	15: 101,053,280	S374G	unknown	Het
Gm4799	A	T	10: 82,954,449		noncoding transcript	Het
Hectd4	T	C	5: 121,343,225		probably null	Het
Ighv1-76	T	C	12: 115,848,038	E65G	probably damaging	Het
Itga9	A	G	9: 118,663,889	D284G	probably damaging	Het
Itpr1	T	C	6: 108,473,529	S1940P	probably benign	Het
Kcnb1	A	G	2: 167,188,071	S185P	probably benign	Het
Kif20a	G	A	18: 34,632,415	A822T	probably benign	Het
Krt1	A	T	15: 101,850,131	F199L	probably damaging	Het
Lpin2	A	G	17: 71,232,276		probably benign	Het
Lrp1b	A	C	2: 41,004,603	D2204E	probably damaging	Het
Mier3	T	A	13: 111,714,850	N427K	probably damaging	Het
Mmp12	GTAATAATAATAATAATAAT	GTAATAATAATAATAAT	9: 7,348,446		probably benign	Het
Mroh3	T	A	1: 136,186,123	M643L	probably benign	Het
Myh11	A	G	16: 14,230,800	S548P	probably damaging	Het
Nat8f6	A	C	6: 85,808,523	L215V	possibly damaging	Het
Nlrp3	G	A	11: 59,548,134	R179Q	probably damaging	Het
Nup88	T	C	11: 70,969,671	E94G	probably benign	Het
Pias1	A	T	9: 62,912,766	D306E	probably benign	Het
Pick1	A	G	15: 79,248,895	D385G	probably benign	Het
Pitx3	A	T	19: 46,137,296		probably benign	Het
Plpp3	T	A	4: 105,194,962		probably null	Het
Prlhr	C	A	19: 60,467,621	R169L	probably damaging	Het
Ptprf	A	C	4: 118,210,382	M1872R	probably damaging	Het
Ptprh	T	C	7: 4,601,940	D35G	probably benign	Het
Rnf130	A	G	11: 50,085,815		probably null	Het
Rnf17	A	C	14: 56,505,988	E1337A	possibly damaging	Het
Sdk2	A	G	11: 113,851,882	Y734H	probably damaging	Het
Slc25a10	C	T	11: 120,498,117	T269I	probably damaging	Het
Slc4a11	A	C	2: 130,684,459	V855G	probably benign	Het
Slc5a5	C	A	8: 70,892,330	R111L	probably damaging	Het
Spg20	A	T	3: 55,135,510	M616L	probably benign	Het
Tmem229a	T	C	6: 24,954,687	D356G	probably damaging	Het
Tmem30c	A	G	16: 57,266,562	S293P	probably damaging	Het
Tnfrsf14	C	A	4: 154,926,598		probably null	Het
Tnfrsf19	C	T	14: 60,971,178	R298H	possibly damaging	Het
Ttc21a	A	G	9: 119,958,792	K809E	probably benign	Het
Ttn	G	A	2: 76,750,209	P23447S	probably damaging	Het
Uap1	T	A	1: 170,151,138		probably null	Het
Wdr82	A	G	9: 106,185,304	Q252R	probably benign	Het
Zfp523	T	C	17: 28,194,993	I34T	probably benign	Het
Zfp808	T	A	13: 62,171,255	H99Q	probably damaging	Het

Other mutations in Igsf9b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00419:Igsf9b	APN	9	27319655	missense	probably damaging	1.00
IGL01013:Igsf9b	APN	9	27334304	missense	probably damaging	1.00
IGL01960:Igsf9b	APN	9	27328606	missense	possibly damaging	0.93
IGL02398:Igsf9b	APN	9	27333130	missense	possibly damaging	0.54
IGL03007:Igsf9b	APN	9	27333082	missense	probably damaging	0.98
G1Funyon:Igsf9b	UTSW	9	27334739	utr 3 prime	probably benign
IGL03014:Igsf9b	UTSW	9	27322636	missense	probably benign	0.00
R0127:Igsf9b	UTSW	9	27334385	missense	possibly damaging	0.65
R0376:Igsf9b	UTSW	9	27334582	missense	probably benign	0.01
R0520:Igsf9b	UTSW	9	27323250	missense	probably benign	0.00
R0534:Igsf9b	UTSW	9	27333062	splice site	probably null
R0613:Igsf9b	UTSW	9	27326920	missense	probably damaging	1.00
R0718:Igsf9b	UTSW	9	27323361	critical splice donor site	probably null
R0828:Igsf9b	UTSW	9	27319605	nonsense	probably null
R0879:Igsf9b	UTSW	9	27333742	missense	probably damaging	1.00
R0882:Igsf9b	UTSW	9	27319316	missense	probably damaging	0.98
R0987:Igsf9b	UTSW	9	27332553	splice site	probably null
R1162:Igsf9b	UTSW	9	27326889	missense	probably benign
R1758:Igsf9b	UTSW	9	27334252	missense	possibly damaging	0.50
R1760:Igsf9b	UTSW	9	27317827	missense	possibly damaging	0.82
R1819:Igsf9b	UTSW	9	27311593	missense	probably damaging	0.98
R1823:Igsf9b	UTSW	9	27331732	missense	probably damaging	0.96
R1982:Igsf9b	UTSW	9	27322239	missense	possibly damaging	0.82
R2150:Igsf9b	UTSW	9	27334337	missense	probably damaging	1.00
R2228:Igsf9b	UTSW	9	27333496	missense	probably damaging	1.00
R2229:Igsf9b	UTSW	9	27333496	missense	probably damaging	1.00
R2250:Igsf9b	UTSW	9	27309478	missense	possibly damaging	0.95
R2872:Igsf9b	UTSW	9	27322223	missense	probably benign	0.11
R2872:Igsf9b	UTSW	9	27322223	missense	probably benign	0.11
R3415:Igsf9b	UTSW	9	27309478	missense	possibly damaging	0.95
R3416:Igsf9b	UTSW	9	27309478	missense	possibly damaging	0.95
R3417:Igsf9b	UTSW	9	27309478	missense	possibly damaging	0.95
R3427:Igsf9b	UTSW	9	27334577	missense	probably damaging	0.99
R4356:Igsf9b	UTSW	9	27309478	missense	possibly damaging	0.95
R4357:Igsf9b	UTSW	9	27309478	missense	possibly damaging	0.95
R4358:Igsf9b	UTSW	9	27309478	missense	possibly damaging	0.95
R4359:Igsf9b	UTSW	9	27309478	missense	possibly damaging	0.95
R4379:Igsf9b	UTSW	9	27309478	missense	possibly damaging	0.95
R4416:Igsf9b	UTSW	9	27322917	missense	probably damaging	1.00
R4445:Igsf9b	UTSW	9	27334252	missense	probably benign	0.13
R4446:Igsf9b	UTSW	9	27334252	missense	probably benign	0.13
R4787:Igsf9b	UTSW	9	27317456	missense	probably benign	0.26
R4887:Igsf9b	UTSW	9	27322650	missense	probably benign	0.45
R5085:Igsf9b	UTSW	9	27317437	missense	probably benign	0.03
R5360:Igsf9b	UTSW	9	27311672	missense	probably damaging	0.98
R5417:Igsf9b	UTSW	9	27334276	small insertion	probably benign
R5686:Igsf9b	UTSW	9	27324179	missense	probably damaging	0.99
R5738:Igsf9b	UTSW	9	27328530	missense	probably damaging	0.98
R6304:Igsf9b	UTSW	9	27342575	missense	probably benign	0.19
R6359:Igsf9b	UTSW	9	27309599	missense	probably benign	0.25
R6367:Igsf9b	UTSW	9	27309525	nonsense	probably null
R6556:Igsf9b	UTSW	9	27329555	missense	probably damaging	1.00
R7058:Igsf9b	UTSW	9	27322854	missense	probably damaging	0.99
R7165:Igsf9b	UTSW	9	27334240	missense	probably benign
R7180:Igsf9b	UTSW	9	27322668	missense	possibly damaging	0.95
R7212:Igsf9b	UTSW	9	27331696	missense	probably damaging	0.98
R7461:Igsf9b	UTSW	9	27334122	missense	probably benign	0.10
R7605:Igsf9b	UTSW	9	27323312	missense	probably damaging	0.98
R7609:Igsf9b	UTSW	9	27345890	missense	probably benign
R7613:Igsf9b	UTSW	9	27334122	missense	probably benign	0.10
R8072:Igsf9b	UTSW	9	27317364	missense	possibly damaging	0.94
R8163:Igsf9b	UTSW	9	27322611	splice site	probably null
R8301:Igsf9b	UTSW	9	27334739	utr 3 prime	probably benign
R8546:Igsf9b	UTSW	9	27333130	missense	possibly damaging	0.54
R8553:Igsf9b	UTSW	9	27333443	missense	probably damaging	0.96
R9438:Igsf9b	UTSW	9	27332543	missense	probably benign	0.03
X0013:Igsf9b	UTSW	9	27331725	missense	possibly damaging	0.89
X0025:Igsf9b	UTSW	9	27309461	missense	probably damaging	1.00
X0028:Igsf9b	UTSW	9	27334372	missense	probably damaging	1.00
Z1176:Igsf9b	UTSW	9	27317353	critical splice acceptor site	probably null
Z1177:Igsf9b	UTSW	9	27334292	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGGACAGGCCAGATGTTAGG -3'
(R):5'- TCAAGTTGTCATCCCTGGC -3'

Sequencing Primer
(F):5'- TGTTAGGAGGGGAGGTAACATTAGTG -3'
(R):5'- AGTTGTCATCCCTGGCACGAC -3'

Posted On

2017-02-10