Incidental Mutation 'R5869:Pias1'
ID454332
Institutional Source Beutler Lab
Gene Symbol Pias1
Ensembl Gene ENSMUSG00000032405
Gene Nameprotein inhibitor of activated STAT 1
SynonymsDdxbp1, GBP, 2900068C24Rik
MMRRC Submission 044077-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.949) question?
Stock #R5869 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location62878368-62987924 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 62912766 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 306 (D306E)
Ref Sequence ENSEMBL: ENSMUSP00000150834 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098651] [ENSMUST00000214830]
Predicted Effect probably benign
Transcript: ENSMUST00000098651
AA Change: D306E

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000096248
Gene: ENSMUSG00000032405
AA Change: D306E

DomainStartEndE-ValueType
SAP 11 45 5.3e-5 SMART
low complexity region 82 95 N/A INTRINSIC
low complexity region 103 116 N/A INTRINSIC
Pfam:PINIT 135 286 9.6e-41 PFAM
Pfam:zf-MIZ 331 380 1.4e-23 PFAM
low complexity region 465 474 N/A INTRINSIC
low complexity region 482 491 N/A INTRINSIC
low complexity region 605 621 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000214830
AA Change: D306E

PolyPhen 2 Score 0.062 (Sensitivity: 0.94; Specificity: 0.84)
Meta Mutation Damage Score 0.0720 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.1%
Validation Efficiency 93% (68/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the protein inhibitor of activated STAT (PIAS) family. PIAS proteins function as SUMO E3 ligases and play important roles in many cellular processes by mediating the sumoylation of target proteins. This protein plays a central role as a transcriptional coregulator of numerous cellular pathways includign the STAT1 and nuclear factor kappaB pathways. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Mar 2016]
PHENOTYPE: Homozygous null mice display partial perinatal lethality, reduced body size, decreased susceptibility to viral infection, and increased susceptibility to bacterial infection and LPS-induced endotoxin shock. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adarb1 T C 10: 77,325,616 probably benign Het
Arsk T C 13: 76,091,784 E100G probably benign Het
Ascc3 C T 10: 50,842,183 R1991* probably null Het
Aspscr1 T C 11: 120,688,920 I31T possibly damaging Het
Asz1 T C 6: 18,074,940 probably benign Het
Calm5 T A 13: 3,854,321 probably benign Het
Car5a G A 8: 121,916,380 T295I probably benign Het
Ccdc174 T A 6: 91,885,418 probably benign Het
Celsr2 G A 3: 108,413,909 A529V probably damaging Het
Cep192 A G 18: 67,815,864 D252G probably benign Het
Clcnka A G 4: 141,394,965 F217L probably benign Het
Cnot3 A T 7: 3,644,930 probably benign Het
Coro1c A G 5: 113,850,846 probably benign Het
Cstf3 A G 2: 104,659,240 probably null Het
Dcdc2a C T 13: 25,107,730 P233S probably benign Het
Ddx55 A G 5: 124,568,682 T581A probably benign Het
Exo1 T C 1: 175,901,283 S638P possibly damaging Het
Fam135a T C 1: 24,029,430 E616G possibly damaging Het
Fignl2 T C 15: 101,053,280 S374G unknown Het
Gm4799 A T 10: 82,954,449 noncoding transcript Het
Hectd4 T C 5: 121,343,225 probably null Het
Ighv1-76 T C 12: 115,848,038 E65G probably damaging Het
Igsf9b C A 9: 27,323,235 H465Q probably benign Het
Itga9 A G 9: 118,663,889 D284G probably damaging Het
Itpr1 T C 6: 108,473,529 S1940P probably benign Het
Kcnb1 A G 2: 167,188,071 S185P probably benign Het
Kif20a G A 18: 34,632,415 A822T probably benign Het
Krt1 A T 15: 101,850,131 F199L probably damaging Het
Lpin2 A G 17: 71,232,276 probably benign Het
Lrp1b A C 2: 41,004,603 D2204E probably damaging Het
Mier3 T A 13: 111,714,850 N427K probably damaging Het
Mmp12 GTAATAATAATAATAATAAT GTAATAATAATAATAAT 9: 7,348,446 probably benign Het
Mroh3 T A 1: 136,186,123 M643L probably benign Het
Myh11 A G 16: 14,230,800 S548P probably damaging Het
Nat8f6 A C 6: 85,808,523 L215V possibly damaging Het
Nlrp3 G A 11: 59,548,134 R179Q probably damaging Het
Nup88 T C 11: 70,969,671 E94G probably benign Het
Pick1 A G 15: 79,248,895 D385G probably benign Het
Pitx3 A T 19: 46,137,296 probably benign Het
Plpp3 T A 4: 105,194,962 probably null Het
Prlhr C A 19: 60,467,621 R169L probably damaging Het
Ptprf A C 4: 118,210,382 M1872R probably damaging Het
Ptprh T C 7: 4,601,940 D35G probably benign Het
Rnf130 A G 11: 50,085,815 probably null Het
Rnf17 A C 14: 56,505,988 E1337A possibly damaging Het
Sdk2 A G 11: 113,851,882 Y734H probably damaging Het
Slc25a10 C T 11: 120,498,117 T269I probably damaging Het
Slc4a11 A C 2: 130,684,459 V855G probably benign Het
Slc5a5 C A 8: 70,892,330 R111L probably damaging Het
Spg20 A T 3: 55,135,510 M616L probably benign Het
Tmem229a T C 6: 24,954,687 D356G probably damaging Het
Tmem30c A G 16: 57,266,562 S293P probably damaging Het
Tnfrsf14 C A 4: 154,926,598 probably null Het
Tnfrsf19 C T 14: 60,971,178 R298H possibly damaging Het
Ttc21a A G 9: 119,958,792 K809E probably benign Het
Ttn G A 2: 76,750,209 P23447S probably damaging Het
Uap1 T A 1: 170,151,138 probably null Het
Wdr82 A G 9: 106,185,304 Q252R probably benign Het
Zfp523 T C 17: 28,194,993 I34T probably benign Het
Zfp808 T A 13: 62,171,255 H99Q probably damaging Het
Other mutations in Pias1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Pias1 APN 9 62923296 missense probably damaging 0.96
IGL01011:Pias1 APN 9 62912855 missense probably benign 0.00
IGL02412:Pias1 APN 9 62893139 missense probably benign 0.44
IGL02728:Pias1 APN 9 62923644 missense probably damaging 1.00
IGL02728:Pias1 APN 9 62923645 missense possibly damaging 0.80
R0479:Pias1 UTSW 9 62893118 splice site probably benign
R0494:Pias1 UTSW 9 62887311 nonsense probably null
R0524:Pias1 UTSW 9 62952178 missense probably damaging 1.00
R0558:Pias1 UTSW 9 62882009 missense possibly damaging 0.82
R1279:Pias1 UTSW 9 62892145 missense probably damaging 0.98
R1525:Pias1 UTSW 9 62920487 missense probably damaging 1.00
R1769:Pias1 UTSW 9 62952178 missense probably damaging 1.00
R2157:Pias1 UTSW 9 62912830 missense possibly damaging 0.63
R2201:Pias1 UTSW 9 62951855 missense possibly damaging 0.94
R4193:Pias1 UTSW 9 62952004 missense possibly damaging 0.80
R4726:Pias1 UTSW 9 62920489 missense probably damaging 0.96
R4880:Pias1 UTSW 9 62912798 missense probably benign 0.32
R5107:Pias1 UTSW 9 62882228 missense probably benign 0.11
R5574:Pias1 UTSW 9 62920493 missense probably damaging 0.99
R5634:Pias1 UTSW 9 62895973 missense probably benign 0.10
R6518:Pias1 UTSW 9 62951860 missense probably damaging 1.00
R6634:Pias1 UTSW 9 62919424 missense probably damaging 1.00
R6798:Pias1 UTSW 9 62892169 missense probably benign
R6799:Pias1 UTSW 9 62882052 missense probably benign 0.10
R7099:Pias1 UTSW 9 62881145 missense
R8361:Pias1 UTSW 9 62919386 missense possibly damaging 0.95
R8510:Pias1 UTSW 9 62923637 missense probably damaging 1.00
X0017:Pias1 UTSW 9 62980845 splice site probably null
Z1177:Pias1 UTSW 9 62912823 missense probably benign 0.31
Predicted Primers PCR Primer
(F):5'- ACTAGGTTCTTGGAGTTTGTAATCC -3'
(R):5'- CTTCGGCAGCCTATAAATCAGG -3'

Sequencing Primer
(F):5'- TCCTCTATAACAACAAGCTCTGG -3'
(R):5'- TCCAGACCTATTCCATGG -3'
Posted On2017-02-10