Mutagenetix > Incidental Mutations

Incidental Mutation 'R5869:Itga9'

454335

Institutional Source

Beutler Lab

Gene Symbol

Itga9

Ensembl Gene

ENSMUSG00000039115

Gene Name

integrin alpha 9

Synonyms

D9Ertd428e, 2610002H11Rik, 6720458D17Rik

MMRRC Submission

044077-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R5869 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

118606690-118901003 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 118663889 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 284 (D284G)

Ref Sequence

ENSEMBL: ENSMUSP00000044227 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000044165]

Predicted Effect

probably damaging
Transcript: ENSMUST00000044165
AA Change: D284G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000044227
Gene: ENSMUSG00000039115
AA Change: D284G

Domain	Start	End	E-Value	Type
signal peptide	1	30	N/A	INTRINSIC
Int_alpha	45	105	8.95e-7	SMART
low complexity region	181	191	N/A	INTRINSIC
Int_alpha	244	297	2.12e-8	SMART
Int_alpha	301	356	1.68e-11	SMART
Int_alpha	361	416	2.9e-15	SMART
Int_alpha	423	476	1.11e-2	SMART
SCOP:d1m1xa2	626	766	3e-32	SMART
SCOP:d1m1xa3	769	970	1e-39	SMART
transmembrane domain	981	1003	N/A	INTRINSIC

Meta Mutation Damage Score

0.2937

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.5%
20x: 92.1%

Validation Efficiency

93% (68/73)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an alpha integrin. Integrins are heterodimeric integral membrane glycoproteins composed of an alpha chain and a beta chain that mediate cell-cell and cell-matrix adhesion. The protein encoded by this gene, when bound to the beta 1 chain, forms an integrin that is a receptor for VCAM1, cytotactin and osteopontin. Expression of this gene has been found to be upregulated in small cell lung cancers. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in respiratory distress leading to postnatal lethality caused by an accumulation of pleural fluid rich in triglyceride, cholesterol and lymphocytes. Mice develop edema and lymphocytic infiltration in the chest wall. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adarb1	T	C	10: 77,325,616		probably benign	Het
Arsk	T	C	13: 76,091,784	E100G	probably benign	Het
Ascc3	C	T	10: 50,842,183	R1991*	probably null	Het
Aspscr1	T	C	11: 120,688,920	I31T	possibly damaging	Het
Asz1	T	C	6: 18,074,940		probably benign	Het
Calm5	T	A	13: 3,854,321		probably benign	Het
Car5a	G	A	8: 121,916,380	T295I	probably benign	Het
Ccdc174	T	A	6: 91,885,418		probably benign	Het
Celsr2	G	A	3: 108,413,909	A529V	probably damaging	Het
Cep192	A	G	18: 67,815,864	D252G	probably benign	Het
Clcnka	A	G	4: 141,394,965	F217L	probably benign	Het
Cnot3	A	T	7: 3,644,930		probably benign	Het
Coro1c	A	G	5: 113,850,846		probably benign	Het
Cstf3	A	G	2: 104,659,240		probably null	Het
Dcdc2a	C	T	13: 25,107,730	P233S	probably benign	Het
Ddx55	A	G	5: 124,568,682	T581A	probably benign	Het
Exo1	T	C	1: 175,901,283	S638P	possibly damaging	Het
Fam135a	T	C	1: 24,029,430	E616G	possibly damaging	Het
Fignl2	T	C	15: 101,053,280	S374G	unknown	Het
Gm4799	A	T	10: 82,954,449		noncoding transcript	Het
Hectd4	T	C	5: 121,343,225		probably null	Het
Ighv1-76	T	C	12: 115,848,038	E65G	probably damaging	Het
Igsf9b	C	A	9: 27,323,235	H465Q	probably benign	Het
Itpr1	T	C	6: 108,473,529	S1940P	probably benign	Het
Kcnb1	A	G	2: 167,188,071	S185P	probably benign	Het
Kif20a	G	A	18: 34,632,415	A822T	probably benign	Het
Krt1	A	T	15: 101,850,131	F199L	probably damaging	Het
Lpin2	A	G	17: 71,232,276		probably benign	Het
Lrp1b	A	C	2: 41,004,603	D2204E	probably damaging	Het
Mier3	T	A	13: 111,714,850	N427K	probably damaging	Het
Mmp12	GTAATAATAATAATAATAAT	GTAATAATAATAATAAT	9: 7,348,446		probably benign	Het
Mroh3	T	A	1: 136,186,123	M643L	probably benign	Het
Myh11	A	G	16: 14,230,800	S548P	probably damaging	Het
Nat8f6	A	C	6: 85,808,523	L215V	possibly damaging	Het
Nlrp3	G	A	11: 59,548,134	R179Q	probably damaging	Het
Nup88	T	C	11: 70,969,671	E94G	probably benign	Het
Pias1	A	T	9: 62,912,766	D306E	probably benign	Het
Pick1	A	G	15: 79,248,895	D385G	probably benign	Het
Pitx3	A	T	19: 46,137,296		probably benign	Het
Plpp3	T	A	4: 105,194,962		probably null	Het
Prlhr	C	A	19: 60,467,621	R169L	probably damaging	Het
Ptprf	A	C	4: 118,210,382	M1872R	probably damaging	Het
Ptprh	T	C	7: 4,601,940	D35G	probably benign	Het
Rnf130	A	G	11: 50,085,815		probably null	Het
Rnf17	A	C	14: 56,505,988	E1337A	possibly damaging	Het
Sdk2	A	G	11: 113,851,882	Y734H	probably damaging	Het
Slc25a10	C	T	11: 120,498,117	T269I	probably damaging	Het
Slc4a11	A	C	2: 130,684,459	V855G	probably benign	Het
Slc5a5	C	A	8: 70,892,330	R111L	probably damaging	Het
Spg20	A	T	3: 55,135,510	M616L	probably benign	Het
Tmem229a	T	C	6: 24,954,687	D356G	probably damaging	Het
Tmem30c	A	G	16: 57,266,562	S293P	probably damaging	Het
Tnfrsf14	C	A	4: 154,926,598		probably null	Het
Tnfrsf19	C	T	14: 60,971,178	R298H	possibly damaging	Het
Ttc21a	A	G	9: 119,958,792	K809E	probably benign	Het
Ttn	G	A	2: 76,750,209	P23447S	probably damaging	Het
Uap1	T	A	1: 170,151,138		probably null	Het
Wdr82	A	G	9: 106,185,304	Q252R	probably benign	Het
Zfp523	T	C	17: 28,194,993	I34T	probably benign	Het
Zfp808	T	A	13: 62,171,255	H99Q	probably damaging	Het

Other mutations in Itga9

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01310:Itga9	APN	9	118769159	start codon destroyed	probably null	0.02
IGL01396:Itga9	APN	9	118607123	splice site	probably benign
IGL01476:Itga9	APN	9	118607111	missense	probably damaging	1.00
IGL01573:Itga9	APN	9	118877230	splice site	probably benign
IGL01958:Itga9	APN	9	118636494	splice site	probably benign
IGL02060:Itga9	APN	9	118661432	missense	probably damaging	1.00
IGL02146:Itga9	APN	9	118834332	missense	possibly damaging	0.50
IGL02391:Itga9	APN	9	118850805	missense	probably benign	0.19
IGL02947:Itga9	APN	9	118658533	missense	probably damaging	1.00
IGL03014:Itga9	UTSW	9	118628144	missense	probably benign
R0052:Itga9	UTSW	9	118636549	missense	probably damaging	1.00
R0052:Itga9	UTSW	9	118636549	missense	probably damaging	1.00
R0142:Itga9	UTSW	9	118636586	missense	probably damaging	0.96
R0179:Itga9	UTSW	9	118661386	missense	probably benign	0.11
R0207:Itga9	UTSW	9	118769253	splice site	probably benign
R0364:Itga9	UTSW	9	118841142	missense	probably benign
R0458:Itga9	UTSW	9	118681028	critical splice donor site	probably null
R1486:Itga9	UTSW	9	118626450	missense	probably damaging	0.98
R1589:Itga9	UTSW	9	118607117	critical splice donor site	probably null
R1620:Itga9	UTSW	9	118843502	missense	probably benign	0.00
R1711:Itga9	UTSW	9	118698461	missense	probably benign	0.00
R1721:Itga9	UTSW	9	118698306	splice site	probably benign
R2064:Itga9	UTSW	9	118807293	missense	probably damaging	0.99
R2201:Itga9	UTSW	9	118877115	splice site	probably benign
R2851:Itga9	UTSW	9	118636536	missense	probably damaging	0.98
R2853:Itga9	UTSW	9	118636536	missense	probably damaging	0.98
R3962:Itga9	UTSW	9	118628186	missense	possibly damaging	0.57
R4180:Itga9	UTSW	9	118607078	missense	probably damaging	1.00
R4597:Itga9	UTSW	9	118843514	missense	probably damaging	1.00
R4716:Itga9	UTSW	9	118681758	missense	probably damaging	0.98
R4929:Itga9	UTSW	9	118807249	missense	probably damaging	1.00
R5002:Itga9	UTSW	9	118663898	nonsense	probably null
R5279:Itga9	UTSW	9	118628205	missense	probably damaging	1.00
R5542:Itga9	UTSW	9	118843661	missense	possibly damaging	0.86
R6372:Itga9	UTSW	9	118897321	missense	probably damaging	1.00
R6470:Itga9	UTSW	9	118897267	missense	probably damaging	0.99
R6581:Itga9	UTSW	9	118658564	missense	probably benign	0.00
R6919:Itga9	UTSW	9	118887815	missense	probably damaging	1.00
R7034:Itga9	UTSW	9	118698365	missense	probably benign	0.00
R7036:Itga9	UTSW	9	118698365	missense	probably benign	0.00
R7043:Itga9	UTSW	9	118769116	missense	probably damaging	0.96
R7237:Itga9	UTSW	9	118636602	missense	probably benign	0.09
R7491:Itga9	UTSW	9	118769111	missense	probably damaging	0.99
R7629:Itga9	UTSW	9	118698446	missense	probably benign	0.00
R7774:Itga9	UTSW	9	118871900	missense	probably damaging	1.00
R7782:Itga9	UTSW	9	118843644	missense
R7789:Itga9	UTSW	9	118658496	missense	possibly damaging	0.80
R7904:Itga9	UTSW	9	118877226	splice site	probably null
R8086:Itga9	UTSW	9	118850801	missense	probably benign
R8158:Itga9	UTSW	9	118877143	missense	probably damaging	0.99
R8204:Itga9	UTSW	9	118871921	missense	probably damaging	1.00
Z1176:Itga9	UTSW	9	118843530	missense	probably benign	0.00
Z1176:Itga9	UTSW	9	118887839	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCTGTGGAGATCCTTTCTGC -3'
(R):5'- GGGCCACAACACCTTTTAAAGC -3'

Sequencing Primer
(F):5'- GTGGAGATCCTTTCTGCCCCAG -3'
(R):5'- CCTTTTAAAGCACACCAGTAGCTTAG -3'

Posted On

2017-02-10