Incidental Mutation 'R5869:Adarb1'
ID 454338
Institutional Source Beutler Lab
Gene Symbol Adarb1
Ensembl Gene ENSMUSG00000020262
Gene Name adenosine deaminase, RNA-specific, B1
Synonyms RED1, D10Bwg0447e, ADAR2, 1700057H01Rik
MMRRC Submission 044077-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R5869 (G1)
Quality Score 211
Status Validated
Chromosome 10
Chromosomal Location 77290726-77418270 bp(-) (GRCm38)
Type of Mutation intron
DNA Base Change (assembly) T to C at 77325616 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000122102 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020496] [ENSMUST00000098374] [ENSMUST00000105404] [ENSMUST00000105406] [ENSMUST00000126073] [ENSMUST00000144547]
AlphaFold Q91ZS8
Predicted Effect probably benign
Transcript: ENSMUST00000020496
SMART Domains Protein: ENSMUSP00000020496
Gene: ENSMUSG00000020262

DomainStartEndE-ValueType
DSRM 79 143 1.9e-22 SMART
low complexity region 192 213 N/A INTRINSIC
low complexity region 220 231 N/A INTRINSIC
DSRM 236 297 5.8e-21 SMART
ADEAMc 322 698 2.1e-196 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000098374
SMART Domains Protein: ENSMUSP00000095976
Gene: ENSMUSG00000020262

DomainStartEndE-ValueType
DSRM 79 143 3.31e-20 SMART
low complexity region 192 213 N/A INTRINSIC
low complexity region 220 231 N/A INTRINSIC
DSRM 236 297 9.87e-19 SMART
ADEAMc 322 708 1.32e-191 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105404
Predicted Effect probably benign
Transcript: ENSMUST00000105406
SMART Domains Protein: ENSMUSP00000101046
Gene: ENSMUSG00000020262

DomainStartEndE-ValueType
DSRM 79 143 3.31e-20 SMART
low complexity region 192 213 N/A INTRINSIC
low complexity region 220 231 N/A INTRINSIC
DSRM 236 297 9.87e-19 SMART
ADEAMc 322 708 1.32e-191 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000126073
Predicted Effect probably benign
Transcript: ENSMUST00000144547
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146319
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149738
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150227
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150512
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154607
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155117
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156583
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.1%
Validation Efficiency 93% (68/73)
MGI Phenotype FUNCTION: This gene encodes a double-stranded-RNA-specific adenosine deaminase that is involved in editing pre-mRNAs by site-specific conversion of adenosine (A) to inosine (I). Substrates for this enzyme include ionotropic glutamate receptors (GluR2-6) and serotonin receptor (5HT2C). Studies in rodents have shown that this protein can modify its own pre-mRNA by A->I editing to create a novel acceptor splice site, alternative splicing to which results in down regulation of its protein expression. Additional splicing events result in transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in progressive seizure susceptibility and death within 20 days of age. Mice homozygous for a conditional allele activated in neurons exhibit motor neuron degeneration, motor function abnormalities, and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arsk T C 13: 76,091,784 E100G probably benign Het
Ascc3 C T 10: 50,842,183 R1991* probably null Het
Aspscr1 T C 11: 120,688,920 I31T possibly damaging Het
Asz1 T C 6: 18,074,940 probably benign Het
Calm5 T A 13: 3,854,321 probably benign Het
Car5a G A 8: 121,916,380 T295I probably benign Het
Ccdc174 T A 6: 91,885,418 probably benign Het
Celsr2 G A 3: 108,413,909 A529V probably damaging Het
Cep192 A G 18: 67,815,864 D252G probably benign Het
Clcnka A G 4: 141,394,965 F217L probably benign Het
Cnot3 A T 7: 3,644,930 probably benign Het
Coro1c A G 5: 113,850,846 probably benign Het
Cstf3 A G 2: 104,659,240 probably null Het
Dcdc2a C T 13: 25,107,730 P233S probably benign Het
Ddx55 A G 5: 124,568,682 T581A probably benign Het
Exo1 T C 1: 175,901,283 S638P possibly damaging Het
Fam135a T C 1: 24,029,430 E616G possibly damaging Het
Fignl2 T C 15: 101,053,280 S374G unknown Het
Gm4799 A T 10: 82,954,449 noncoding transcript Het
Hectd4 T C 5: 121,343,225 probably null Het
Ighv1-76 T C 12: 115,848,038 E65G probably damaging Het
Igsf9b C A 9: 27,323,235 H465Q probably benign Het
Itga9 A G 9: 118,663,889 D284G probably damaging Het
Itpr1 T C 6: 108,473,529 S1940P probably benign Het
Kcnb1 A G 2: 167,188,071 S185P probably benign Het
Kif20a G A 18: 34,632,415 A822T probably benign Het
Krt1 A T 15: 101,850,131 F199L probably damaging Het
Lpin2 A G 17: 71,232,276 probably benign Het
Lrp1b A C 2: 41,004,603 D2204E probably damaging Het
Mier3 T A 13: 111,714,850 N427K probably damaging Het
Mmp12 GTAATAATAATAATAATAAT GTAATAATAATAATAAT 9: 7,348,446 probably benign Het
Mroh3 T A 1: 136,186,123 M643L probably benign Het
Myh11 A G 16: 14,230,800 S548P probably damaging Het
Nat8f6 A C 6: 85,808,523 L215V possibly damaging Het
Nlrp3 G A 11: 59,548,134 R179Q probably damaging Het
Nup88 T C 11: 70,969,671 E94G probably benign Het
Pias1 A T 9: 62,912,766 D306E probably benign Het
Pick1 A G 15: 79,248,895 D385G probably benign Het
Pitx3 A T 19: 46,137,296 probably benign Het
Plpp3 T A 4: 105,194,962 probably null Het
Prlhr C A 19: 60,467,621 R169L probably damaging Het
Ptprf A C 4: 118,210,382 M1872R probably damaging Het
Ptprh T C 7: 4,601,940 D35G probably benign Het
Rnf130 A G 11: 50,085,815 probably null Het
Rnf17 A C 14: 56,505,988 E1337A possibly damaging Het
Sdk2 A G 11: 113,851,882 Y734H probably damaging Het
Slc25a10 C T 11: 120,498,117 T269I probably damaging Het
Slc4a11 A C 2: 130,684,459 V855G probably benign Het
Slc5a5 C A 8: 70,892,330 R111L probably damaging Het
Spg20 A T 3: 55,135,510 M616L probably benign Het
Tmem229a T C 6: 24,954,687 D356G probably damaging Het
Tmem30c A G 16: 57,266,562 S293P probably damaging Het
Tnfrsf14 C A 4: 154,926,598 probably null Het
Tnfrsf19 C T 14: 60,971,178 R298H possibly damaging Het
Ttc21a A G 9: 119,958,792 K809E probably benign Het
Ttn G A 2: 76,750,209 P23447S probably damaging Het
Uap1 T A 1: 170,151,138 probably null Het
Wdr82 A G 9: 106,185,304 Q252R probably benign Het
Zfp523 T C 17: 28,194,993 I34T probably benign Het
Zfp808 T A 13: 62,171,255 H99Q probably damaging Het
Other mutations in Adarb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00736:Adarb1 APN 10 77322490 missense probably damaging 1.00
IGL01996:Adarb1 APN 10 77322217 missense probably damaging 1.00
IGL02173:Adarb1 APN 10 77321825 missense probably damaging 1.00
IGL02214:Adarb1 APN 10 77322301 missense probably damaging 0.99
IGL02399:Adarb1 APN 10 77295754 missense probably benign 0.02
IGL02699:Adarb1 APN 10 77322019 missense probably benign
IGL02867:Adarb1 APN 10 77313541 missense probably benign 0.01
IGL02889:Adarb1 APN 10 77313541 missense probably benign 0.01
IGL03133:Adarb1 APN 10 77325896 start gained probably benign
R1806:Adarb1 UTSW 10 77322265 missense probably damaging 0.98
R1834:Adarb1 UTSW 10 77317231 splice site probably benign
R2174:Adarb1 UTSW 10 77295798 missense probably benign 0.35
R2233:Adarb1 UTSW 10 77317349 missense probably damaging 1.00
R2234:Adarb1 UTSW 10 77317349 missense probably damaging 1.00
R2908:Adarb1 UTSW 10 77313403 critical splice donor site probably null
R3106:Adarb1 UTSW 10 77321757 missense probably damaging 1.00
R5104:Adarb1 UTSW 10 77322287 missense probably damaging 1.00
R5134:Adarb1 UTSW 10 77325845 intron probably benign
R5497:Adarb1 UTSW 10 77325889 missense probably damaging 0.96
R6168:Adarb1 UTSW 10 77322319 missense probably damaging 1.00
R7372:Adarb1 UTSW 10 77295878 critical splice acceptor site probably null
R7575:Adarb1 UTSW 10 77303295 missense probably damaging 0.99
R7885:Adarb1 UTSW 10 77295708 missense possibly damaging 0.50
R9227:Adarb1 UTSW 10 77321792 missense probably damaging 1.00
R9230:Adarb1 UTSW 10 77321792 missense probably damaging 1.00
R9350:Adarb1 UTSW 10 77322433 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- AAGATCATGCGGACTCCCTTC -3'
(R):5'- AGGCCTATCACATAGTGTCAAATAG -3'

Sequencing Primer
(F):5'- GACTCCCTTCCCTCCGAGG -3'
(R):5'- CACATAGTGTCAAATAGTTCACATCC -3'
Posted On 2017-02-10