Incidental Mutation 'R0555:Aurka'
ID45434
Institutional Source Beutler Lab
Gene Symbol Aurka
Ensembl Gene ENSMUSG00000027496
Gene Nameaurora kinase A
SynonymsIAK, IAK1, Aurora-A, aurora A, Ark1, Ayk1, AIRK1, Stk6
MMRRC Submission 038747-MU
Accession Numbers

Ncbi RefSeq: NM_011497.3; MGI:894678

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0555 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location172356190-172370535 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 172367147 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 23 (R23C)
Ref Sequence ENSEMBL: ENSMUSP00000104768 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028997] [ENSMUST00000109139] [ENSMUST00000109140] [ENSMUST00000116375] [ENSMUST00000151511]
Predicted Effect probably benign
Transcript: ENSMUST00000028997
AA Change: R45C

PolyPhen 2 Score 0.033 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000028997
Gene: ENSMUSG00000027496
AA Change: R45C

DomainStartEndE-ValueType
S_TKc 146 396 2.25e-99 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109139
AA Change: R23C

PolyPhen 2 Score 0.070 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000104767
Gene: ENSMUSG00000027496
AA Change: R23C

DomainStartEndE-ValueType
S_TKc 124 374 2.25e-99 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109140
AA Change: R23C

PolyPhen 2 Score 0.070 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000104768
Gene: ENSMUSG00000027496
AA Change: R23C

DomainStartEndE-ValueType
S_TKc 124 374 2.25e-99 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000116375
SMART Domains Protein: ENSMUSP00000112076
Gene: ENSMUSG00000027498

DomainStartEndE-ValueType
Pfam:CSTF1_dimer 6 62 5.4e-28 PFAM
WD40 97 136 2.61e-3 SMART
WD40 162 201 3.29e-9 SMART
WD40 206 245 6.88e0 SMART
WD40 248 290 9.02e-7 SMART
WD40 293 334 1.44e-5 SMART
Blast:WD40 337 382 8e-9 BLAST
WD40 385 425 2.49e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126107
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128004
Predicted Effect probably benign
Transcript: ENSMUST00000151511
SMART Domains Protein: ENSMUSP00000121178
Gene: ENSMUSG00000027498

DomainStartEndE-ValueType
PDB:2XZ2|A 8 59 2e-7 PDB
WD40 97 136 2.61e-3 SMART
Meta Mutation Damage Score 0.1511 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.8%
  • 10x: 96.9%
  • 20x: 93.8%
Validation Efficiency 100% (98/98)
MGI Phenotype Strain: 3836423; 3826513
Lethality: E1-E4
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a cell cycle-regulated kinase that appears to be involved in microtubule formation and/or stabilization at the spindle pole during chromosome segregation. The encoded protein is found at the centrosome in interphase cells and at the spindle poles in mitosis. This gene may play a role in tumor development and progression. A processed pseudogene of this gene has been found on chromosome 1, and an unprocessed pseudogene has been found on chromosome 10. Multiple transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele display embryonic lethality before implantation, early embryonic growth arrest, and impaired mitosis. Heterozygous null mice display increased incidence of tumors primarily lymphomas and chromosomal instability. [provided by MGI curators]
Allele List at MGI

All alleles(25) : Targeted(4) Gene trapped(21)

Other mutations in this stock
Total: 96 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam10 T A 9: 70,754,234 I363N probably damaging Het
Ahcyl2 T C 6: 29,890,671 probably benign Het
Asap1 A G 15: 64,094,364 L941P probably damaging Het
Cacna1c C T 6: 118,612,625 R1446H probably damaging Het
Casp8ap2 T A 4: 32,640,381 H478Q probably damaging Het
Clcn4 C T 7: 7,290,504 A418T possibly damaging Het
Cpxm2 A T 7: 132,044,043 Y715* probably null Het
Csmd1 T C 8: 16,185,273 M1179V probably benign Het
Ddx21 A T 10: 62,587,528 F632I probably damaging Het
Dnaic1 C A 4: 41,625,335 T433K possibly damaging Het
Dpyd G A 3: 119,431,542 G988D probably damaging Het
Dync1i2 AAAAGAAGAGGAAAGAAGAGGAAAG AAAAGAAGAGGAAAG 2: 71,214,518 probably null Het
Dync1li2 A T 8: 104,420,665 S466T probably benign Het
Ears2 T C 7: 122,048,444 T206A probably benign Het
Elmod1 A T 9: 53,931,592 probably benign Het
Eps8l3 C A 3: 107,892,345 D590E probably benign Het
Etfdh A T 3: 79,605,805 H370Q probably benign Het
Fam83g C A 11: 61,707,663 A792E probably benign Het
Ffar3 G T 7: 30,855,537 Y119* probably null Het
Fosb G T 7: 19,307,213 S118R possibly damaging Het
Foxn4 G A 5: 114,263,114 L3F probably damaging Het
Foxo4 A G X: 101,255,178 K65E probably damaging Het
Frem2 A G 3: 53,516,860 L3052P probably damaging Het
Fubp3 G A 2: 31,608,137 R101H probably damaging Het
Gba2 C A 4: 43,569,927 G429C probably damaging Het
Gimap1 T C 6: 48,741,429 probably benign Het
Gm17657 A T 17: 29,519,571 F74I probably benign Het
Gnas A G 2: 174,298,511 T158A possibly damaging Het
Gpc5 T C 14: 115,552,328 V538A probably damaging Het
Greb1l T C 18: 10,458,781 probably benign Het
H2-M10.5 G A 17: 36,774,728 G260R probably damaging Het
Hbs1l A C 10: 21,349,323 Q412H probably benign Het
Hecw1 G T 13: 14,236,941 T1058N probably damaging Het
Heph A T X: 96,558,084 T1027S probably damaging Het
Hoga1 A C 19: 42,046,075 E53A possibly damaging Het
Insrr T G 3: 87,814,437 probably benign Het
Ipo11 A T 13: 106,892,461 V328D probably damaging Het
Jakmip1 T C 5: 37,118,873 V509A probably damaging Het
Jmjd1c T C 10: 67,225,789 V1307A probably benign Het
Kmt2a T A 9: 44,847,571 S1027C probably damaging Het
Kprp G C 3: 92,824,357 P462R unknown Het
Lman1l T C 9: 57,614,101 T193A probably benign Het
Lrit3 A T 3: 129,791,296 V271D probably damaging Het
Map4 T A 9: 109,979,103 probably benign Het
Mark4 A C 7: 19,448,673 probably benign Het
Mfsd14b A G 13: 65,078,445 V142A probably benign Het
Mis18bp1 A T 12: 65,161,453 I162N possibly damaging Het
Mrpl43 A T 19: 45,005,952 probably benign Het
Mrpl47 A G 3: 32,736,693 F16S probably benign Het
Myh2 G T 11: 67,178,967 G380C probably damaging Het
Myo15 T C 11: 60,521,638 Y3284H probably damaging Het
Nectin2 A G 7: 19,733,223 probably benign Het
Neu3 A G 7: 99,814,183 V111A probably damaging Het
Nol4l T C 2: 153,417,684 probably null Het
Nphp3 C A 9: 104,023,434 H510Q probably damaging Het
Nprl3 T A 11: 32,233,118 probably null Het
Olfr292 A G 7: 86,695,308 N284S probably damaging Het
Olfr48 T C 2: 89,844,443 T177A probably benign Het
Olfr598 T C 7: 103,328,963 V159A probably benign Het
Olfr791 T C 10: 129,526,896 I223T possibly damaging Het
Pex1 A G 5: 3,606,130 E319G possibly damaging Het
Phtf1 C A 3: 104,004,469 T709K probably damaging Het
Plek2 A T 12: 78,892,172 L271Q probably damaging Het
Plekhg5 T A 4: 152,107,469 C421* probably null Het
Polk A C 13: 96,484,179 C525W probably damaging Het
Ppfibp2 T C 7: 107,729,174 S471P probably damaging Het
Prickle2 A T 6: 92,458,565 F74L probably benign Het
Prl7d1 A T 13: 27,712,055 V113D probably benign Het
Prr14 C T 7: 127,472,095 probably benign Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Ret A G 6: 118,178,610 V375A probably damaging Het
Rora T C 9: 69,361,746 F41S probably damaging Het
Sall1 T C 8: 89,031,758 T573A probably benign Het
Shb A G 4: 45,458,321 V281A possibly damaging Het
Slc25a26 A T 6: 94,592,410 probably null Het
Sltm T C 9: 70,586,081 F769L probably damaging Het
Snx9 T A 17: 5,918,413 M328K probably damaging Het
Stk25 G T 1: 93,624,591 Q356K probably benign Het
Svep1 T A 4: 58,128,858 Y613F possibly damaging Het
Syne4 G A 7: 30,316,744 A195T probably damaging Het
Tmem8 T C 17: 26,117,114 L130S probably benign Het
Trcg1 C T 9: 57,242,333 T396M probably damaging Het
Trim30b A G 7: 104,357,298 V117A possibly damaging Het
Trpc4 T C 3: 54,302,090 probably benign Het
Ttll4 A G 1: 74,688,280 H827R probably damaging Het
Urgcp T C 11: 5,717,477 E287G probably damaging Het
Usp2 G T 9: 44,092,784 L319F probably damaging Het
Vmn1r167 A T 7: 23,505,087 V168D probably damaging Het
Vmn2r100 C A 17: 19,522,120 P252Q possibly damaging Het
Vmn2r61 A T 7: 42,266,018 I130F probably benign Het
Vmn2r63 A T 7: 42,928,528 Y195* probably null Het
Vmn2r81 T C 10: 79,293,449 S725P probably damaging Het
Wnt10b A G 15: 98,772,937 probably benign Het
Zcchc6 A G 13: 59,800,317 V328A probably benign Het
Zfp292 T C 4: 34,807,194 E1950G probably damaging Het
Zfyve16 A G 13: 92,516,520 probably benign Het
Other mutations in Aurka
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01458:Aurka APN 2 172368979 unclassified probably benign
IGL02338:Aurka APN 2 172359858 missense probably benign 0.00
IGL02894:Aurka APN 2 172366948 splice site probably null
IGL03188:Aurka APN 2 172363768 missense possibly damaging 0.60
PIT4585001:Aurka UTSW 2 172357197 missense probably benign 0.01
R0006:Aurka UTSW 2 172359753 critical splice donor site probably null
R0006:Aurka UTSW 2 172359753 critical splice donor site probably null
R0458:Aurka UTSW 2 172370446 nonsense probably null
R1130:Aurka UTSW 2 172357258 splice site probably null
R1140:Aurka UTSW 2 172357229 missense probably damaging 1.00
R2507:Aurka UTSW 2 172370445 missense probably benign 0.00
R2887:Aurka UTSW 2 172367120 missense probably benign 0.01
R2889:Aurka UTSW 2 172367120 missense probably benign 0.01
R3772:Aurka UTSW 2 172366960 missense probably benign
R4929:Aurka UTSW 2 172370406 missense probably benign 0.05
R5409:Aurka UTSW 2 172367116 missense possibly damaging 0.78
R6158:Aurka UTSW 2 172363596 critical splice donor site probably null
R6689:Aurka UTSW 2 172370393 critical splice donor site probably null
R6828:Aurka UTSW 2 172357252 missense probably damaging 1.00
R7912:Aurka UTSW 2 172369029 missense probably benign 0.00
R8066:Aurka UTSW 2 172370418 missense probably benign 0.00
R8301:Aurka UTSW 2 172356930 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCTATGCATTTGAGCACCCAAGACC -3'
(R):5'- ACAATAAGGCAGCTTCAGCCGC -3'

Sequencing Primer
(F):5'- GGTTATTGAGCCGGGACAC -3'
(R):5'- agccagaagagagggtcag -3'
Posted On2013-06-11