Incidental Mutation 'R5869:Aspscr1'
ID454345
Institutional Source Beutler Lab
Gene Symbol Aspscr1
Ensembl Gene ENSMUSG00000025142
Gene Namealveolar soft part sarcoma chromosome region, candidate 1 (human)
SynonymsASPCR1, RCC17, TUG, ASPC, ASPL, 1190006K01Rik
MMRRC Submission 044077-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5869 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location120672973-120709447 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 120688920 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 31 (I31T)
Ref Sequence ENSEMBL: ENSMUSP00000125931 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026135] [ENSMUST00000103016] [ENSMUST00000106158] [ENSMUST00000106159] [ENSMUST00000106160] [ENSMUST00000131727] [ENSMUST00000135346] [ENSMUST00000143844] [ENSMUST00000149389] [ENSMUST00000151160] [ENSMUST00000153346] [ENSMUST00000168510] [ENSMUST00000168714] [ENSMUST00000168097]
Predicted Effect probably benign
Transcript: ENSMUST00000026135
AA Change: I172T

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000026135
Gene: ENSMUSG00000025142
AA Change: I172T

DomainStartEndE-ValueType
Pfam:TUG-UBL1 15 78 1.4e-29 PFAM
low complexity region 193 206 N/A INTRINSIC
low complexity region 284 313 N/A INTRINSIC
coiled coil region 339 365 N/A INTRINSIC
UBX 378 459 1.67e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000103016
AA Change: I95T

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000099305
Gene: ENSMUSG00000025142
AA Change: I95T

DomainStartEndE-ValueType
low complexity region 116 129 N/A INTRINSIC
low complexity region 207 236 N/A INTRINSIC
coiled coil region 262 288 N/A INTRINSIC
UBX 301 382 1.67e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106158
AA Change: I95T

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000101764
Gene: ENSMUSG00000025142
AA Change: I95T

DomainStartEndE-ValueType
low complexity region 116 129 N/A INTRINSIC
low complexity region 207 236 N/A INTRINSIC
coiled coil region 262 288 N/A INTRINSIC
Blast:UBX 301 361 2e-29 BLAST
SCOP:d1h8ca_ 308 364 2e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106159
AA Change: I95T

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000101765
Gene: ENSMUSG00000025142
AA Change: I95T

DomainStartEndE-ValueType
low complexity region 116 129 N/A INTRINSIC
low complexity region 207 236 N/A INTRINSIC
coiled coil region 262 288 N/A INTRINSIC
UBX 301 382 1.67e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106160
AA Change: I95T

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000101766
Gene: ENSMUSG00000025142
AA Change: I95T

DomainStartEndE-ValueType
low complexity region 116 129 N/A INTRINSIC
low complexity region 207 236 N/A INTRINSIC
coiled coil region 262 288 N/A INTRINSIC
Blast:UBX 301 361 2e-29 BLAST
SCOP:d1h8ca_ 308 364 2e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000131727
AA Change: I95T

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000117654
Gene: ENSMUSG00000025142
AA Change: I95T

DomainStartEndE-ValueType
low complexity region 116 129 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000135346
AA Change: I95T

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000120072
Gene: ENSMUSG00000025142
AA Change: I95T

DomainStartEndE-ValueType
low complexity region 116 129 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000143844
Predicted Effect probably benign
Transcript: ENSMUST00000149389
AA Change: I157T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000122216
Gene: ENSMUSG00000025142
AA Change: I157T

DomainStartEndE-ValueType
Pfam:TUG-UBL1 3 63 3.7e-24 PFAM
low complexity region 178 191 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000151160
AA Change: I95T

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000116447
Gene: ENSMUSG00000025142
AA Change: I95T

DomainStartEndE-ValueType
low complexity region 116 129 N/A INTRINSIC
low complexity region 207 220 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000153346
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163273
Predicted Effect probably benign
Transcript: ENSMUST00000166838
SMART Domains Protein: ENSMUSP00000127202
Gene: ENSMUSG00000025142

DomainStartEndE-ValueType
low complexity region 2 24 N/A INTRINSIC
coiled coil region 49 75 N/A INTRINSIC
Blast:UBX 89 119 7e-13 BLAST
SCOP:d1i42a_ 92 119 4e-3 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000168510
AA Change: I31T

PolyPhen 2 Score 0.548 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000125931
Gene: ENSMUSG00000025142
AA Change: I31T

DomainStartEndE-ValueType
low complexity region 52 65 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000167678
SMART Domains Protein: ENSMUSP00000128940
Gene: ENSMUSG00000025142

DomainStartEndE-ValueType
low complexity region 3 12 N/A INTRINSIC
coiled coil region 37 63 N/A INTRINSIC
Blast:UBX 77 107 8e-13 BLAST
SCOP:d1i42a_ 80 107 5e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000168714
SMART Domains Protein: ENSMUSP00000129462
Gene: ENSMUSG00000025142

DomainStartEndE-ValueType
SCOP:d1h8ca_ 12 82 2e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000168097
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.1%
Validation Efficiency 93% (68/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains a UBX domain and interacts with glucose transporter type 4 (GLUT4). This protein is a tether, which sequesters the GLUT4 in intracellular vesicles in muscle and fat cells in the absence of insulin, and redistributes the GLUT4 to the plasma membrane within minutes of insulin stimulation. Translocation t(X;17)(p11;q25) of this gene with transcription factor TFE3 gene results in a ASPSCR1-TFE3 fusion protein in alveolar soft part sarcoma and in renal cell carcinomas. Multiple alternatively spliced transcript variants have been found. [provided by RefSeq, Oct 2011]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adarb1 T C 10: 77,325,616 probably benign Het
Arsk T C 13: 76,091,784 E100G probably benign Het
Ascc3 C T 10: 50,842,183 R1991* probably null Het
Asz1 T C 6: 18,074,940 probably benign Het
Calm5 T A 13: 3,854,321 probably benign Het
Car5a G A 8: 121,916,380 T295I probably benign Het
Ccdc174 T A 6: 91,885,418 probably benign Het
Celsr2 G A 3: 108,413,909 A529V probably damaging Het
Cep192 A G 18: 67,815,864 D252G probably benign Het
Clcnka A G 4: 141,394,965 F217L probably benign Het
Cnot3 A T 7: 3,644,930 probably benign Het
Coro1c A G 5: 113,850,846 probably benign Het
Cstf3 A G 2: 104,659,240 probably null Het
Dcdc2a C T 13: 25,107,730 P233S probably benign Het
Ddx55 A G 5: 124,568,682 T581A probably benign Het
Exo1 T C 1: 175,901,283 S638P possibly damaging Het
Fam135a T C 1: 24,029,430 E616G possibly damaging Het
Fignl2 T C 15: 101,053,280 S374G unknown Het
Gm4799 A T 10: 82,954,449 noncoding transcript Het
Hectd4 T C 5: 121,343,225 probably null Het
Ighv1-76 T C 12: 115,848,038 E65G probably damaging Het
Igsf9b C A 9: 27,323,235 H465Q probably benign Het
Itga9 A G 9: 118,663,889 D284G probably damaging Het
Itpr1 T C 6: 108,473,529 S1940P probably benign Het
Kcnb1 A G 2: 167,188,071 S185P probably benign Het
Kif20a G A 18: 34,632,415 A822T probably benign Het
Krt1 A T 15: 101,850,131 F199L probably damaging Het
Lpin2 A G 17: 71,232,276 probably benign Het
Lrp1b A C 2: 41,004,603 D2204E probably damaging Het
Mier3 T A 13: 111,714,850 N427K probably damaging Het
Mmp12 GTAATAATAATAATAATAAT GTAATAATAATAATAAT 9: 7,348,446 probably benign Het
Mroh3 T A 1: 136,186,123 M643L probably benign Het
Myh11 A G 16: 14,230,800 S548P probably damaging Het
Nat8f6 A C 6: 85,808,523 L215V possibly damaging Het
Nlrp3 G A 11: 59,548,134 R179Q probably damaging Het
Nup88 T C 11: 70,969,671 E94G probably benign Het
Pias1 A T 9: 62,912,766 D306E probably benign Het
Pick1 A G 15: 79,248,895 D385G probably benign Het
Pitx3 A T 19: 46,137,296 probably benign Het
Plpp3 T A 4: 105,194,962 probably null Het
Prlhr C A 19: 60,467,621 R169L probably damaging Het
Ptprf A C 4: 118,210,382 M1872R probably damaging Het
Ptprh T C 7: 4,601,940 D35G probably benign Het
Rnf130 A G 11: 50,085,815 probably null Het
Rnf17 A C 14: 56,505,988 E1337A possibly damaging Het
Sdk2 A G 11: 113,851,882 Y734H probably damaging Het
Slc25a10 C T 11: 120,498,117 T269I probably damaging Het
Slc4a11 A C 2: 130,684,459 V855G probably benign Het
Slc5a5 C A 8: 70,892,330 R111L probably damaging Het
Spg20 A T 3: 55,135,510 M616L probably benign Het
Tmem229a T C 6: 24,954,687 D356G probably damaging Het
Tmem30c A G 16: 57,266,562 S293P probably damaging Het
Tnfrsf14 C A 4: 154,926,598 probably null Het
Tnfrsf19 C T 14: 60,971,178 R298H possibly damaging Het
Ttc21a A G 9: 119,958,792 K809E probably benign Het
Ttn G A 2: 76,750,209 P23447S probably damaging Het
Uap1 T A 1: 170,151,138 probably null Het
Wdr82 A G 9: 106,185,304 Q252R probably benign Het
Zfp523 T C 17: 28,194,993 I34T probably benign Het
Zfp808 T A 13: 62,171,255 H99Q probably damaging Het
Other mutations in Aspscr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02588:Aspscr1 APN 11 120677531 missense possibly damaging 0.93
IGL02683:Aspscr1 APN 11 120701226 missense probably damaging 1.00
IGL02719:Aspscr1 APN 11 120677579 missense probably damaging 1.00
I1329:Aspscr1 UTSW 11 120701240 missense probably damaging 0.99
R0113:Aspscr1 UTSW 11 120688925 missense probably damaging 1.00
R0277:Aspscr1 UTSW 11 120678420 missense probably damaging 1.00
R0323:Aspscr1 UTSW 11 120678420 missense probably damaging 1.00
R0457:Aspscr1 UTSW 11 120677618 missense probably benign 0.35
R0714:Aspscr1 UTSW 11 120703667 critical splice donor site probably null
R1435:Aspscr1 UTSW 11 120689222 missense probably benign 0.00
R1509:Aspscr1 UTSW 11 120701516 missense probably damaging 1.00
R1739:Aspscr1 UTSW 11 120678516 missense probably damaging 1.00
R1789:Aspscr1 UTSW 11 120688560 missense probably damaging 1.00
R1958:Aspscr1 UTSW 11 120689208 missense probably null 1.00
R2414:Aspscr1 UTSW 11 120689222 missense probably benign 0.00
R2432:Aspscr1 UTSW 11 120702566 intron probably benign
R4059:Aspscr1 UTSW 11 120686679 missense probably benign 0.22
R4159:Aspscr1 UTSW 11 120708676 missense probably damaging 1.00
R4703:Aspscr1 UTSW 11 120688945 missense possibly damaging 0.87
R4705:Aspscr1 UTSW 11 120688945 missense possibly damaging 0.87
R4748:Aspscr1 UTSW 11 120701507 missense probably damaging 0.99
R5141:Aspscr1 UTSW 11 120689177 missense probably benign 0.01
R7543:Aspscr1 UTSW 11 120709423 missense unknown
R7555:Aspscr1 UTSW 11 120673100 missense unknown
R7609:Aspscr1 UTSW 11 120677522 missense probably damaging 0.99
R7670:Aspscr1 UTSW 11 120689039 missense probably benign 0.00
R7946:Aspscr1 UTSW 11 120708617 missense
R7999:Aspscr1 UTSW 11 120678522 critical splice donor site probably null
R8299:Aspscr1 UTSW 11 120709074 missense
Predicted Primers PCR Primer
(F):5'- ACCCTAGAACGTCAGAGACTG -3'
(R):5'- TGTTTGCATCACCCTCATGG -3'

Sequencing Primer
(F):5'- CTGAGGTGGGAGAGCCTG -3'
(R):5'- GGTTTAGGTCTCCCCTGCTGAAC -3'
Posted On2017-02-10