Incidental Mutation 'R0555:Gnas'
ID45435
Institutional Source Beutler Lab
Gene Symbol Gnas
Ensembl Gene ENSMUSG00000027523
Gene NameGNAS (guanine nucleotide binding protein, alpha stimulating) complex locus
SynonymsGnasxl, C130027O20Rik, 5530400H20Rik, Nespl, Nesp, A930027G11Rik, Gs alpha, G alpha s, Gsa, Nesp55, Galphas, Gnas1, P1, Gs-alpha, XLalphas, P3, neuroendocrine-specific Golgi protein p55 isoform 1, Oedsml, P2
MMRRC Submission 038747-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0555 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location174284320-174346744 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 174298511 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 158 (T158A)
Ref Sequence ENSEMBL: ENSMUSP00000139839 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080493] [ENSMUST00000087876] [ENSMUST00000087877] [ENSMUST00000109088] [ENSMUST00000109095] [ENSMUST00000109096] [ENSMUST00000130761] [ENSMUST00000130940] [ENSMUST00000180362] [ENSMUST00000185956] [ENSMUST00000186907]
Predicted Effect unknown
Transcript: ENSMUST00000080493
AA Change: D217G
SMART Domains Protein: ENSMUSP00000079341
Gene: ENSMUSG00000027523
AA Change: D217G

DomainStartEndE-ValueType
low complexity region 19 48 N/A INTRINSIC
internal_repeat_1 89 166 3.02e-8 PROSPERO
internal_repeat_1 209 276 3.02e-8 PROSPERO
low complexity region 350 365 N/A INTRINSIC
low complexity region 391 404 N/A INTRINSIC
low complexity region 459 477 N/A INTRINSIC
low complexity region 480 498 N/A INTRINSIC
low complexity region 515 525 N/A INTRINSIC
low complexity region 535 570 N/A INTRINSIC
low complexity region 576 626 N/A INTRINSIC
low complexity region 633 643 N/A INTRINSIC
low complexity region 659 678 N/A INTRINSIC
low complexity region 685 696 N/A INTRINSIC
G_alpha 759 1132 5.01e-185 SMART
Predicted Effect unknown
Transcript: ENSMUST00000087876
AA Change: D217G
SMART Domains Protein: ENSMUSP00000085184
Gene: ENSMUSG00000027523
AA Change: D217G

DomainStartEndE-ValueType
low complexity region 19 48 N/A INTRINSIC
internal_repeat_1 89 166 2.42e-8 PROSPERO
internal_repeat_1 209 276 2.42e-8 PROSPERO
low complexity region 350 365 N/A INTRINSIC
low complexity region 391 404 N/A INTRINSIC
low complexity region 459 477 N/A INTRINSIC
low complexity region 480 498 N/A INTRINSIC
low complexity region 515 525 N/A INTRINSIC
low complexity region 535 570 N/A INTRINSIC
low complexity region 576 626 N/A INTRINSIC
low complexity region 633 643 N/A INTRINSIC
low complexity region 659 678 N/A INTRINSIC
low complexity region 685 696 N/A INTRINSIC
G_alpha 759 1118 8.32e-191 SMART
Predicted Effect unknown
Transcript: ENSMUST00000087877
AA Change: D217G
SMART Domains Protein: ENSMUSP00000085185
Gene: ENSMUSG00000027523
AA Change: D217G

DomainStartEndE-ValueType
low complexity region 19 48 N/A INTRINSIC
internal_repeat_1 89 166 1.1e-8 PROSPERO
internal_repeat_1 209 276 1.1e-8 PROSPERO
low complexity region 350 365 N/A INTRINSIC
low complexity region 391 404 N/A INTRINSIC
low complexity region 459 477 N/A INTRINSIC
low complexity region 480 498 N/A INTRINSIC
low complexity region 515 525 N/A INTRINSIC
low complexity region 535 570 N/A INTRINSIC
low complexity region 576 626 N/A INTRINSIC
low complexity region 633 643 N/A INTRINSIC
low complexity region 659 678 N/A INTRINSIC
low complexity region 685 696 N/A INTRINSIC
Blast:G_alpha 759 799 2e-14 BLAST
low complexity region 802 816 N/A INTRINSIC
low complexity region 847 859 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000109088
AA Change: T158A

PolyPhen 2 Score 0.784 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000104716
Gene: ENSMUSG00000027523
AA Change: T158A

DomainStartEndE-ValueType
low complexity region 192 209 N/A INTRINSIC
low complexity region 336 352 N/A INTRINSIC
low complexity region 402 415 N/A INTRINSIC
low complexity region 421 446 N/A INTRINSIC
low complexity region 459 481 N/A INTRINSIC
low complexity region 493 510 N/A INTRINSIC
low complexity region 529 599 N/A INTRINSIC
low complexity region 643 658 N/A INTRINSIC
low complexity region 700 716 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109095
SMART Domains Protein: ENSMUSP00000104723
Gene: ENSMUSG00000027523

DomainStartEndE-ValueType
Pfam:NESP55 1 253 1.2e-157 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109096
SMART Domains Protein: ENSMUSP00000104724
Gene: ENSMUSG00000027523

DomainStartEndE-ValueType
Pfam:NESP55 1 253 1.2e-157 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000130761
Predicted Effect probably benign
Transcript: ENSMUST00000130940
SMART Domains Protein: ENSMUSP00000118210
Gene: ENSMUSG00000027523

DomainStartEndE-ValueType
Pfam:NESP55 1 59 1.6e-30 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150276
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151472
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154658
Predicted Effect probably benign
Transcript: ENSMUST00000180362
SMART Domains Protein: ENSMUSP00000136180
Gene: ENSMUSG00000027523

DomainStartEndE-ValueType
Pfam:NESP55 1 253 1.2e-157 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183673
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184327
Predicted Effect unknown
Transcript: ENSMUST00000185956
AA Change: D217G
SMART Domains Protein: ENSMUSP00000140174
Gene: ENSMUSG00000027523
AA Change: D217G

DomainStartEndE-ValueType
low complexity region 19 48 N/A INTRINSIC
internal_repeat_1 89 166 3.02e-8 PROSPERO
internal_repeat_1 209 276 3.02e-8 PROSPERO
low complexity region 350 365 N/A INTRINSIC
low complexity region 391 404 N/A INTRINSIC
low complexity region 459 477 N/A INTRINSIC
low complexity region 480 498 N/A INTRINSIC
low complexity region 515 525 N/A INTRINSIC
low complexity region 535 570 N/A INTRINSIC
low complexity region 576 626 N/A INTRINSIC
low complexity region 633 643 N/A INTRINSIC
low complexity region 659 678 N/A INTRINSIC
low complexity region 685 696 N/A INTRINSIC
G_alpha 759 1132 5.01e-185 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000186907
AA Change: T158A

PolyPhen 2 Score 0.784 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000139839
Gene: ENSMUSG00000027523
AA Change: T158A

DomainStartEndE-ValueType
low complexity region 192 209 N/A INTRINSIC
low complexity region 336 352 N/A INTRINSIC
low complexity region 402 415 N/A INTRINSIC
low complexity region 421 446 N/A INTRINSIC
low complexity region 459 481 N/A INTRINSIC
low complexity region 493 510 N/A INTRINSIC
low complexity region 529 599 N/A INTRINSIC
low complexity region 643 658 N/A INTRINSIC
low complexity region 700 716 N/A INTRINSIC
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.8%
  • 10x: 96.9%
  • 20x: 93.8%
Validation Efficiency 100% (98/98)
MGI Phenotype FUNCTION: This locus has a highly complex imprinted expression pattern. It gives rise to maternally, paternally, and biallelically expressed transcripts that are derived from four alternative promoters and 5' exons. Some transcripts contain a differentially methylated region (DMR) at their 5' exons, which is commonly found in imprinted genes and correlates with transcript expression. This gene has an antisense transcript. One of the transcripts produced from this locus, and the antisense transcript, are both paternally expressed noncoding RNAs, and may regulate imprinting in this region. In addition, one of the transcripts contains a second overlapping ORF, which encodes a structurally unrelated protein - Alex. Alternative splicing of downstream exons is also observed, which results in different forms of the stimulatory G-protein alpha subunit, a key element of the classical signal transduction pathway linking receptor-ligand interactions with the activation of adenylyl cyclase and a variety of cellular reponses. Additional transcript variants have been found for this gene, but the full-length nature and/or biological validity of some variants have not been determined. [provided by RefSeq, Jun 2015]
PHENOTYPE: Mutant homozygotes stop developing normally by embryonic day 10.5 and die prenatally. On some backgrounds heterozygotes show imprinted phenotypes, including differences in body shape/weight, locomotor activity, metabolism, and developmental anomalies. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 96 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam10 T A 9: 70,754,234 I363N probably damaging Het
Ahcyl2 T C 6: 29,890,671 probably benign Het
Asap1 A G 15: 64,094,364 L941P probably damaging Het
Aurka G A 2: 172,367,147 R23C probably benign Het
Cacna1c C T 6: 118,612,625 R1446H probably damaging Het
Casp8ap2 T A 4: 32,640,381 H478Q probably damaging Het
Clcn4 C T 7: 7,290,504 A418T possibly damaging Het
Cpxm2 A T 7: 132,044,043 Y715* probably null Het
Csmd1 T C 8: 16,185,273 M1179V probably benign Het
Ddx21 A T 10: 62,587,528 F632I probably damaging Het
Dnaic1 C A 4: 41,625,335 T433K possibly damaging Het
Dpyd G A 3: 119,431,542 G988D probably damaging Het
Dync1i2 AAAAGAAGAGGAAAGAAGAGGAAAG AAAAGAAGAGGAAAG 2: 71,214,518 probably null Het
Dync1li2 A T 8: 104,420,665 S466T probably benign Het
Ears2 T C 7: 122,048,444 T206A probably benign Het
Elmod1 A T 9: 53,931,592 probably benign Het
Eps8l3 C A 3: 107,892,345 D590E probably benign Het
Etfdh A T 3: 79,605,805 H370Q probably benign Het
Fam83g C A 11: 61,707,663 A792E probably benign Het
Ffar3 G T 7: 30,855,537 Y119* probably null Het
Fosb G T 7: 19,307,213 S118R possibly damaging Het
Foxn4 G A 5: 114,263,114 L3F probably damaging Het
Foxo4 A G X: 101,255,178 K65E probably damaging Het
Frem2 A G 3: 53,516,860 L3052P probably damaging Het
Fubp3 G A 2: 31,608,137 R101H probably damaging Het
Gba2 C A 4: 43,569,927 G429C probably damaging Het
Gimap1 T C 6: 48,741,429 probably benign Het
Gm17657 A T 17: 29,519,571 F74I probably benign Het
Gpc5 T C 14: 115,552,328 V538A probably damaging Het
Greb1l T C 18: 10,458,781 probably benign Het
H2-M10.5 G A 17: 36,774,728 G260R probably damaging Het
Hbs1l A C 10: 21,349,323 Q412H probably benign Het
Hecw1 G T 13: 14,236,941 T1058N probably damaging Het
Heph A T X: 96,558,084 T1027S probably damaging Het
Hoga1 A C 19: 42,046,075 E53A possibly damaging Het
Insrr T G 3: 87,814,437 probably benign Het
Ipo11 A T 13: 106,892,461 V328D probably damaging Het
Jakmip1 T C 5: 37,118,873 V509A probably damaging Het
Jmjd1c T C 10: 67,225,789 V1307A probably benign Het
Kmt2a T A 9: 44,847,571 S1027C probably damaging Het
Kprp G C 3: 92,824,357 P462R unknown Het
Lman1l T C 9: 57,614,101 T193A probably benign Het
Lrit3 A T 3: 129,791,296 V271D probably damaging Het
Map4 T A 9: 109,979,103 probably benign Het
Mark4 A C 7: 19,448,673 probably benign Het
Mfsd14b A G 13: 65,078,445 V142A probably benign Het
Mis18bp1 A T 12: 65,161,453 I162N possibly damaging Het
Mrpl43 A T 19: 45,005,952 probably benign Het
Mrpl47 A G 3: 32,736,693 F16S probably benign Het
Myh2 G T 11: 67,178,967 G380C probably damaging Het
Myo15 T C 11: 60,521,638 Y3284H probably damaging Het
Nectin2 A G 7: 19,733,223 probably benign Het
Neu3 A G 7: 99,814,183 V111A probably damaging Het
Nol4l T C 2: 153,417,684 probably null Het
Nphp3 C A 9: 104,023,434 H510Q probably damaging Het
Nprl3 T A 11: 32,233,118 probably null Het
Olfr292 A G 7: 86,695,308 N284S probably damaging Het
Olfr48 T C 2: 89,844,443 T177A probably benign Het
Olfr598 T C 7: 103,328,963 V159A probably benign Het
Olfr791 T C 10: 129,526,896 I223T possibly damaging Het
Pex1 A G 5: 3,606,130 E319G possibly damaging Het
Phtf1 C A 3: 104,004,469 T709K probably damaging Het
Plek2 A T 12: 78,892,172 L271Q probably damaging Het
Plekhg5 T A 4: 152,107,469 C421* probably null Het
Polk A C 13: 96,484,179 C525W probably damaging Het
Ppfibp2 T C 7: 107,729,174 S471P probably damaging Het
Prickle2 A T 6: 92,458,565 F74L probably benign Het
Prl7d1 A T 13: 27,712,055 V113D probably benign Het
Prr14 C T 7: 127,472,095 probably benign Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Ret A G 6: 118,178,610 V375A probably damaging Het
Rora T C 9: 69,361,746 F41S probably damaging Het
Sall1 T C 8: 89,031,758 T573A probably benign Het
Shb A G 4: 45,458,321 V281A possibly damaging Het
Slc25a26 A T 6: 94,592,410 probably null Het
Sltm T C 9: 70,586,081 F769L probably damaging Het
Snx9 T A 17: 5,918,413 M328K probably damaging Het
Stk25 G T 1: 93,624,591 Q356K probably benign Het
Svep1 T A 4: 58,128,858 Y613F possibly damaging Het
Syne4 G A 7: 30,316,744 A195T probably damaging Het
Tmem8 T C 17: 26,117,114 L130S probably benign Het
Trcg1 C T 9: 57,242,333 T396M probably damaging Het
Trim30b A G 7: 104,357,298 V117A possibly damaging Het
Trpc4 T C 3: 54,302,090 probably benign Het
Ttll4 A G 1: 74,688,280 H827R probably damaging Het
Urgcp T C 11: 5,717,477 E287G probably damaging Het
Usp2 G T 9: 44,092,784 L319F probably damaging Het
Vmn1r167 A T 7: 23,505,087 V168D probably damaging Het
Vmn2r100 C A 17: 19,522,120 P252Q possibly damaging Het
Vmn2r61 A T 7: 42,266,018 I130F probably benign Het
Vmn2r63 A T 7: 42,928,528 Y195* probably null Het
Vmn2r81 T C 10: 79,293,449 S725P probably damaging Het
Wnt10b A G 15: 98,772,937 probably benign Het
Zcchc6 A G 13: 59,800,317 V328A probably benign Het
Zfp292 T C 4: 34,807,194 E1950G probably damaging Het
Zfyve16 A G 13: 92,516,520 probably benign Het
Other mutations in Gnas
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00565:Gnas APN 2 174341711 splice site probably benign
IGL00928:Gnas APN 2 174297953 nonsense probably null
IGL01014:Gnas APN 2 174297974 utr 5 prime probably benign
IGL01743:Gnas APN 2 174298332 nonsense probably null
IGL01808:Gnas APN 2 174298697 missense probably damaging 0.96
IGL02559:Gnas APN 2 174341936 splice site probably benign
R0627:Gnas UTSW 2 174298135 intron probably benign
R1418:Gnas UTSW 2 174345214 splice site probably benign
R1706:Gnas UTSW 2 174299975 missense possibly damaging 0.90
R1751:Gnas UTSW 2 174297894 utr 5 prime probably benign
R1968:Gnas UTSW 2 174298733 missense probably damaging 0.96
R2290:Gnas UTSW 2 174300010 missense probably benign 0.09
R4125:Gnas UTSW 2 174300165 missense possibly damaging 0.94
R4128:Gnas UTSW 2 174300165 missense possibly damaging 0.94
R4697:Gnas UTSW 2 174298080 missense probably damaging 1.00
R4888:Gnas UTSW 2 174298089 missense possibly damaging 0.94
R5458:Gnas UTSW 2 174298331 missense probably benign 0.41
R5640:Gnas UTSW 2 174284971 missense probably benign 0.44
R5696:Gnas UTSW 2 174299675 intron probably benign
R5757:Gnas UTSW 2 174345247 missense probably damaging 1.00
R6053:Gnas UTSW 2 174299852 missense possibly damaging 0.89
R6083:Gnas UTSW 2 174297862 start codon destroyed probably null
R6736:Gnas UTSW 2 174334251 missense probably damaging 0.98
R7074:Gnas UTSW 2 174285049 missense probably damaging 1.00
R7239:Gnas UTSW 2 174298615 missense unknown
R7541:Gnas UTSW 2 174298099 missense unknown
R7679:Gnas UTSW 2 174284831 missense probably damaging 0.99
R7694:Gnas UTSW 2 174300212 missense probably damaging 1.00
R7713:Gnas UTSW 2 174299027 missense unknown
R7834:Gnas UTSW 2 174298990 nonsense probably null
R7917:Gnas UTSW 2 174298990 nonsense probably null
X0022:Gnas UTSW 2 174299744 missense probably benign 0.33
Z1088:Gnas UTSW 2 174298373 missense probably benign 0.27
Z1176:Gnas UTSW 2 174298606 missense unknown
Z1177:Gnas UTSW 2 174284887 missense unknown
Predicted Primers PCR Primer
(F):5'- AGGAAGCCATGCCATTCGAGAC -3'
(R):5'- CAATGGAGGCTCTGCCAATCTCAAG -3'

Sequencing Primer
(F):5'- AACCCAGCGATTTTGGAGC -3'
(R):5'- TCTGCCAATCTCAAGCAGGG -3'
Posted On2013-06-11