Mutagenetix > Incidental Mutations

Incidental Mutation 'R5869:Rnf17'

454352

Institutional Source

Beutler Lab

Gene Symbol

Rnf17

Ensembl Gene

ENSMUSG00000000365

Gene Name

ring finger protein 17

Synonyms

MMIP-2

MMRRC Submission

044077-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.453) question?

Stock #

R5869 (G1)

Quality Score

147

Status

Validated

Chromosome

Chromosomal Location

56402581-56525032 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 56505988 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Alanine at position 1337 (E1337A)

Ref Sequence

ENSEMBL: ENSMUSP00000093469 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000095793]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000095793
AA Change: E1337A

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000093469
Gene: ENSMUSG00000000365
AA Change: E1337A

Domain	Start	End	E-Value	Type
Blast:RING	9	72	2e-15	BLAST
low complexity region	398	405	N/A	INTRINSIC
Pfam:TUDOR	440	522	8.2e-8	PFAM
TUDOR	750	807	4.32e-12	SMART
low complexity region	824	836	N/A	INTRINSIC
Blast:TUDOR	850	882	1e-8	BLAST
low complexity region	959	970	N/A	INTRINSIC
TUDOR	984	1042	1.29e-1	SMART
low complexity region	1128	1139	N/A	INTRINSIC
TUDOR	1245	1301	7.7e-9	SMART
low complexity region	1416	1430	N/A	INTRINSIC
TUDOR	1495	1554	1e-7	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000225737

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.5%
20x: 92.1%

Validation Efficiency

93% (68/73)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is similar to a mouse gene that encodes a testis-specific protein containing a RING finger domain. Alternatively spliced transcript variants encoding different isoforms have been found. [provided by RefSeq, May 2010]
PHENOTYPE: Homozygous null mice display male infertility, azoospermia, arrest of spermatogenesis, and small testis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adarb1	T	C	10: 77,325,616		probably benign	Het
Arsk	T	C	13: 76,091,784	E100G	probably benign	Het
Ascc3	C	T	10: 50,842,183	R1991*	probably null	Het
Aspscr1	T	C	11: 120,688,920	I31T	possibly damaging	Het
Asz1	T	C	6: 18,074,940		probably benign	Het
Calm5	T	A	13: 3,854,321		probably benign	Het
Car5a	G	A	8: 121,916,380	T295I	probably benign	Het
Ccdc174	T	A	6: 91,885,418		probably benign	Het
Celsr2	G	A	3: 108,413,909	A529V	probably damaging	Het
Cep192	A	G	18: 67,815,864	D252G	probably benign	Het
Clcnka	A	G	4: 141,394,965	F217L	probably benign	Het
Cnot3	A	T	7: 3,644,930		probably benign	Het
Coro1c	A	G	5: 113,850,846		probably benign	Het
Cstf3	A	G	2: 104,659,240		probably null	Het
Dcdc2a	C	T	13: 25,107,730	P233S	probably benign	Het
Ddx55	A	G	5: 124,568,682	T581A	probably benign	Het
Exo1	T	C	1: 175,901,283	S638P	possibly damaging	Het
Fam135a	T	C	1: 24,029,430	E616G	possibly damaging	Het
Fignl2	T	C	15: 101,053,280	S374G	unknown	Het
Gm4799	A	T	10: 82,954,449		noncoding transcript	Het
Hectd4	T	C	5: 121,343,225		probably null	Het
Ighv1-76	T	C	12: 115,848,038	E65G	probably damaging	Het
Igsf9b	C	A	9: 27,323,235	H465Q	probably benign	Het
Itga9	A	G	9: 118,663,889	D284G	probably damaging	Het
Itpr1	T	C	6: 108,473,529	S1940P	probably benign	Het
Kcnb1	A	G	2: 167,188,071	S185P	probably benign	Het
Kif20a	G	A	18: 34,632,415	A822T	probably benign	Het
Krt1	A	T	15: 101,850,131	F199L	probably damaging	Het
Lpin2	A	G	17: 71,232,276		probably benign	Het
Lrp1b	A	C	2: 41,004,603	D2204E	probably damaging	Het
Mier3	T	A	13: 111,714,850	N427K	probably damaging	Het
Mmp12	GTAATAATAATAATAATAAT	GTAATAATAATAATAAT	9: 7,348,446		probably benign	Het
Mroh3	T	A	1: 136,186,123	M643L	probably benign	Het
Myh11	A	G	16: 14,230,800	S548P	probably damaging	Het
Nat8f6	A	C	6: 85,808,523	L215V	possibly damaging	Het
Nlrp3	G	A	11: 59,548,134	R179Q	probably damaging	Het
Nup88	T	C	11: 70,969,671	E94G	probably benign	Het
Pias1	A	T	9: 62,912,766	D306E	probably benign	Het
Pick1	A	G	15: 79,248,895	D385G	probably benign	Het
Pitx3	A	T	19: 46,137,296		probably benign	Het
Plpp3	T	A	4: 105,194,962		probably null	Het
Prlhr	C	A	19: 60,467,621	R169L	probably damaging	Het
Ptprf	A	C	4: 118,210,382	M1872R	probably damaging	Het
Ptprh	T	C	7: 4,601,940	D35G	probably benign	Het
Rnf130	A	G	11: 50,085,815		probably null	Het
Sdk2	A	G	11: 113,851,882	Y734H	probably damaging	Het
Slc25a10	C	T	11: 120,498,117	T269I	probably damaging	Het
Slc4a11	A	C	2: 130,684,459	V855G	probably benign	Het
Slc5a5	C	A	8: 70,892,330	R111L	probably damaging	Het
Spg20	A	T	3: 55,135,510	M616L	probably benign	Het
Tmem229a	T	C	6: 24,954,687	D356G	probably damaging	Het
Tmem30c	A	G	16: 57,266,562	S293P	probably damaging	Het
Tnfrsf14	C	A	4: 154,926,598		probably null	Het
Tnfrsf19	C	T	14: 60,971,178	R298H	possibly damaging	Het
Ttc21a	A	G	9: 119,958,792	K809E	probably benign	Het
Ttn	G	A	2: 76,750,209	P23447S	probably damaging	Het
Uap1	T	A	1: 170,151,138		probably null	Het
Wdr82	A	G	9: 106,185,304	Q252R	probably benign	Het
Zfp523	T	C	17: 28,194,993	I34T	probably benign	Het
Zfp808	T	A	13: 62,171,255	H99Q	probably damaging	Het

Other mutations in Rnf17

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00586:Rnf17	APN	14	56421082	missense	probably damaging	0.99
IGL00717:Rnf17	APN	14	56465750	missense	probably benign	0.00
IGL00978:Rnf17	APN	14	56512271	missense	probably damaging	1.00
IGL01295:Rnf17	APN	14	56463064	nonsense	probably null
IGL01779:Rnf17	APN	14	56462063	missense	probably benign	0.06
IGL02132:Rnf17	APN	14	56421166	missense	probably benign	0.27
IGL02183:Rnf17	APN	14	56507868	missense	probably null	0.99
IGL02387:Rnf17	APN	14	56500587	missense	probably damaging	1.00
IGL02422:Rnf17	APN	14	56482135	missense	probably damaging	1.00
IGL03081:Rnf17	APN	14	56434371	missense	probably benign	0.03
IGL03269:Rnf17	APN	14	56427946	missense	possibly damaging	0.74
R0046:Rnf17	UTSW	14	56471373	missense	probably damaging	1.00
R0046:Rnf17	UTSW	14	56471373	missense	probably damaging	1.00
R0089:Rnf17	UTSW	14	56514106	missense	probably damaging	1.00
R0189:Rnf17	UTSW	14	56482193	missense	probably null	1.00
R0243:Rnf17	UTSW	14	56482084	missense	possibly damaging	0.80
R0245:Rnf17	UTSW	14	56438609	missense	probably damaging	0.97
R0486:Rnf17	UTSW	14	56514175	missense	probably benign	0.43
R0554:Rnf17	UTSW	14	56522550	missense	probably damaging	1.00
R0840:Rnf17	UTSW	14	56475447	missense	probably damaging	1.00
R1169:Rnf17	UTSW	14	56514165	missense	possibly damaging	0.89
R1170:Rnf17	UTSW	14	56425631	missense	probably benign	0.10
R1200:Rnf17	UTSW	14	56467706	missense	probably benign	0.44
R1464:Rnf17	UTSW	14	56461911	missense	probably damaging	1.00
R1464:Rnf17	UTSW	14	56461911	missense	probably damaging	1.00
R1472:Rnf17	UTSW	14	56427979	missense	probably damaging	1.00
R1512:Rnf17	UTSW	14	56467786	missense	probably benign	0.01
R1605:Rnf17	UTSW	14	56493365	missense	probably damaging	1.00
R1778:Rnf17	UTSW	14	56522399	missense	probably damaging	0.99
R1791:Rnf17	UTSW	14	56504007	nonsense	probably null
R2015:Rnf17	UTSW	14	56486969	missense	probably benign	0.00
R2023:Rnf17	UTSW	14	56431579	missense	possibly damaging	0.59
R2086:Rnf17	UTSW	14	56483380	missense	probably damaging	0.98
R2130:Rnf17	UTSW	14	56493354	missense	probably damaging	1.00
R2309:Rnf17	UTSW	14	56505982	missense	possibly damaging	0.95
R3003:Rnf17	UTSW	14	56500547	missense	probably damaging	1.00
R3611:Rnf17	UTSW	14	56467740	missense	probably benign	0.43
R3847:Rnf17	UTSW	14	56512296	missense	probably damaging	1.00
R3848:Rnf17	UTSW	14	56512296	missense	probably damaging	1.00
R3849:Rnf17	UTSW	14	56512296	missense	probably damaging	1.00
R3850:Rnf17	UTSW	14	56512296	missense	probably damaging	1.00
R3872:Rnf17	UTSW	14	56475413	missense	possibly damaging	0.89
R3874:Rnf17	UTSW	14	56475413	missense	possibly damaging	0.89
R4021:Rnf17	UTSW	14	56460001	missense	probably damaging	0.98
R4022:Rnf17	UTSW	14	56460001	missense	probably damaging	0.98
R4790:Rnf17	UTSW	14	56434355	missense	probably damaging	1.00
R4951:Rnf17	UTSW	14	56522391	missense	probably benign	0.02
R5068:Rnf17	UTSW	14	56505928	missense	probably damaging	0.99
R5069:Rnf17	UTSW	14	56505928	missense	probably damaging	0.99
R5070:Rnf17	UTSW	14	56505928	missense	probably damaging	0.99
R5518:Rnf17	UTSW	14	56482133	missense	probably damaging	1.00
R5628:Rnf17	UTSW	14	56486952	splice site	probably null
R5712:Rnf17	UTSW	14	56471399	missense	probably benign	0.19
R5747:Rnf17	UTSW	14	56465819	critical splice donor site	probably null
R6336:Rnf17	UTSW	14	56421169	splice site	probably null
R6626:Rnf17	UTSW	14	56427924	missense	possibly damaging	0.92
R6639:Rnf17	UTSW	14	56438743	missense	probably benign	0.01
R6675:Rnf17	UTSW	14	56459975	missense	probably damaging	1.00
R6731:Rnf17	UTSW	14	56524350	missense	possibly damaging	0.93
R7062:Rnf17	UTSW	14	56465654	missense	probably benign	0.00
R7103:Rnf17	UTSW	14	56471306	missense	possibly damaging	0.63
R7144:Rnf17	UTSW	14	56512332	splice site	probably null
R7527:Rnf17	UTSW	14	56516438	missense	probably damaging	1.00
R7664:Rnf17	UTSW	14	56438878	missense	probably damaging	1.00
R7754:Rnf17	UTSW	14	56462072	critical splice donor site	probably null
R7772:Rnf17	UTSW	14	56477687	missense	probably benign	0.27
R8092:Rnf17	UTSW	14	56487022	missense	probably benign	0.00
R8150:Rnf17	UTSW	14	56421136	missense	probably benign	0.19
R8203:Rnf17	UTSW	14	56467722	missense	probably benign	0.17
R8320:Rnf17	UTSW	14	56424542	frame shift	probably null
R8321:Rnf17	UTSW	14	56424542	frame shift	probably null
R8379:Rnf17	UTSW	14	56424542	frame shift	probably null
R8380:Rnf17	UTSW	14	56424542	frame shift	probably null
R8381:Rnf17	UTSW	14	56424542	frame shift	probably null
R8382:Rnf17	UTSW	14	56424542	frame shift	probably null
R8383:Rnf17	UTSW	14	56424542	frame shift	probably null
Z1177:Rnf17	UTSW	14	56467706	missense	possibly damaging	0.66

Predicted Primers

PCR Primer
(F):5'- TGTTGACTGCCCATGGTACTC -3'
(R):5'- CTTATGAAATGTCTCAGCAACTTGC -3'

Sequencing Primer
(F):5'- CATGTGCATTTAGTTCTACTACCAGG -3'
(R):5'- GCAACTTGCTCAAAATTAGGCTTGC -3'

Posted On

2017-02-10