Incidental Mutation 'R5869:Pick1'
ID 454354
Institutional Source Beutler Lab
Gene Symbol Pick1
Ensembl Gene ENSMUSG00000116121
Gene Name
Synonyms Prkcabp
MMRRC Submission 044077-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.734) question?
Stock # R5869 (G1)
Quality Score 223
Status Validated
Chromosome 15
Chromosomal Location 79229391-79256674 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 79248895 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 385 (D385G)
Ref Sequence ENSEMBL: ENSMUSP00000129468 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018295] [ENSMUST00000039752] [ENSMUST00000053926] [ENSMUST00000163571] [ENSMUST00000166155]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000018295
AA Change: D385G

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000018295
Gene: ENSMUSG00000068206
AA Change: D385G

DomainStartEndE-ValueType
PDZ 31 105 2.12e-13 SMART
Arfaptin 117 352 1.69e-122 SMART
low complexity region 380 391 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000039752
SMART Domains Protein: ENSMUSP00000040522
Gene: ENSMUSG00000032988

DomainStartEndE-ValueType
low complexity region 2 19 N/A INTRINSIC
Pfam:MFS_1 20 349 1.3e-28 PFAM
transmembrane domain 353 372 N/A INTRINSIC
transmembrane domain 387 409 N/A INTRINSIC
low complexity region 465 480 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000053926
SMART Domains Protein: ENSMUSP00000061125
Gene: ENSMUSG00000116121

DomainStartEndE-ValueType
PDZ 31 105 2.12e-13 SMART
Arfaptin 117 363 1.18e-103 SMART
GLECT 393 530 7.99e-3 SMART
Gal-bind_lectin 399 530 4.49e-22 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000113954
Predicted Effect probably benign
Transcript: ENSMUST00000163571
AA Change: D385G

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000128126
Gene: ENSMUSG00000068206
AA Change: D385G

DomainStartEndE-ValueType
PDZ 31 105 2.12e-13 SMART
Arfaptin 117 352 1.69e-122 SMART
low complexity region 380 391 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165609
Predicted Effect probably benign
Transcript: ENSMUST00000166155
AA Change: D385G

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000129468
Gene: ENSMUSG00000068206
AA Change: D385G

DomainStartEndE-ValueType
PDZ 31 105 2.12e-13 SMART
Arfaptin 117 352 1.69e-122 SMART
low complexity region 380 391 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168513
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169548
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171581
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172162
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230477
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.1%
Validation Efficiency 93% (68/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains a PDZ domain, through which it interacts with protein kinase C, alpha (PRKCA). This protein may function as an adaptor that binds to and organizes the subcellular localization of a variety of membrane proteins. It has been shown to interact with multiple glutamate receptor subtypes, monoamine plasma membrane transporters, as well as non-voltage gated sodium channels, and may target PRKCA to these membrane proteins and thus regulate their distribution and function. This protein has also been found to act as an anchoring protein that specifically targets PRKCA to mitochondria in a ligand-specific manner. Three transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele show impaired synaptic plasticity and lack of long-term depression; males are infertile due to reduced sperm count and impaired sperm motility, and display small testes and seminiferous tubules, malformed acrosomes, globozoospermia, and male germ cell apoptosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adarb1 T C 10: 77,325,616 probably benign Het
Arsk T C 13: 76,091,784 E100G probably benign Het
Ascc3 C T 10: 50,842,183 R1991* probably null Het
Aspscr1 T C 11: 120,688,920 I31T possibly damaging Het
Asz1 T C 6: 18,074,940 probably benign Het
Calm5 T A 13: 3,854,321 probably benign Het
Car5a G A 8: 121,916,380 T295I probably benign Het
Ccdc174 T A 6: 91,885,418 probably benign Het
Celsr2 G A 3: 108,413,909 A529V probably damaging Het
Cep192 A G 18: 67,815,864 D252G probably benign Het
Clcnka A G 4: 141,394,965 F217L probably benign Het
Cnot3 A T 7: 3,644,930 probably benign Het
Coro1c A G 5: 113,850,846 probably benign Het
Cstf3 A G 2: 104,659,240 probably null Het
Dcdc2a C T 13: 25,107,730 P233S probably benign Het
Ddx55 A G 5: 124,568,682 T581A probably benign Het
Exo1 T C 1: 175,901,283 S638P possibly damaging Het
Fam135a T C 1: 24,029,430 E616G possibly damaging Het
Fignl2 T C 15: 101,053,280 S374G unknown Het
Gm4799 A T 10: 82,954,449 noncoding transcript Het
Hectd4 T C 5: 121,343,225 probably null Het
Ighv1-76 T C 12: 115,848,038 E65G probably damaging Het
Igsf9b C A 9: 27,323,235 H465Q probably benign Het
Itga9 A G 9: 118,663,889 D284G probably damaging Het
Itpr1 T C 6: 108,473,529 S1940P probably benign Het
Kcnb1 A G 2: 167,188,071 S185P probably benign Het
Kif20a G A 18: 34,632,415 A822T probably benign Het
Krt1 A T 15: 101,850,131 F199L probably damaging Het
Lpin2 A G 17: 71,232,276 probably benign Het
Lrp1b A C 2: 41,004,603 D2204E probably damaging Het
Mier3 T A 13: 111,714,850 N427K probably damaging Het
Mmp12 GTAATAATAATAATAATAAT GTAATAATAATAATAAT 9: 7,348,446 probably benign Het
Mroh3 T A 1: 136,186,123 M643L probably benign Het
Myh11 A G 16: 14,230,800 S548P probably damaging Het
Nat8f6 A C 6: 85,808,523 L215V possibly damaging Het
Nlrp3 G A 11: 59,548,134 R179Q probably damaging Het
Nup88 T C 11: 70,969,671 E94G probably benign Het
Pias1 A T 9: 62,912,766 D306E probably benign Het
Pitx3 A T 19: 46,137,296 probably benign Het
Plpp3 T A 4: 105,194,962 probably null Het
Prlhr C A 19: 60,467,621 R169L probably damaging Het
Ptprf A C 4: 118,210,382 M1872R probably damaging Het
Ptprh T C 7: 4,601,940 D35G probably benign Het
Rnf130 A G 11: 50,085,815 probably null Het
Rnf17 A C 14: 56,505,988 E1337A possibly damaging Het
Sdk2 A G 11: 113,851,882 Y734H probably damaging Het
Slc25a10 C T 11: 120,498,117 T269I probably damaging Het
Slc4a11 A C 2: 130,684,459 V855G probably benign Het
Slc5a5 C A 8: 70,892,330 R111L probably damaging Het
Spg20 A T 3: 55,135,510 M616L probably benign Het
Tmem229a T C 6: 24,954,687 D356G probably damaging Het
Tmem30c A G 16: 57,266,562 S293P probably damaging Het
Tnfrsf14 C A 4: 154,926,598 probably null Het
Tnfrsf19 C T 14: 60,971,178 R298H possibly damaging Het
Ttc21a A G 9: 119,958,792 K809E probably benign Het
Ttn G A 2: 76,750,209 P23447S probably damaging Het
Uap1 T A 1: 170,151,138 probably null Het
Wdr82 A G 9: 106,185,304 Q252R probably benign Het
Zfp523 T C 17: 28,194,993 I34T probably benign Het
Zfp808 T A 13: 62,171,255 H99Q probably damaging Het
Other mutations in Pick1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Pick1 APN 15 79247257 splice site probably benign
IGL03137:Pick1 APN 15 79245301 missense possibly damaging 0.61
IGL03366:Pick1 APN 15 79241281 missense probably damaging 0.97
FR4976:Pick1 UTSW 15 79255946 frame shift probably null
R1590:Pick1 UTSW 15 79245301 missense probably benign 0.40
R2114:Pick1 UTSW 15 79255581 unclassified probably benign
R2115:Pick1 UTSW 15 79255581 unclassified probably benign
R2219:Pick1 UTSW 15 79239699 missense probably damaging 1.00
R4624:Pick1 UTSW 15 79246466 missense probably damaging 1.00
R4646:Pick1 UTSW 15 79248937 missense probably benign 0.26
R4796:Pick1 UTSW 15 79255610 unclassified probably benign
R5420:Pick1 UTSW 15 79248840 missense probably benign 0.01
R6047:Pick1 UTSW 15 79255695 unclassified probably benign
R6128:Pick1 UTSW 15 79239696 missense probably damaging 0.98
R6291:Pick1 UTSW 15 79251728 splice site probably null
R7042:Pick1 UTSW 15 79248765 missense probably damaging 0.98
R7564:Pick1 UTSW 15 79255581 missense unknown
R8211:Pick1 UTSW 15 79248730 missense probably damaging 1.00
R8870:Pick1 UTSW 15 79255907 missense unknown
R9354:Pick1 UTSW 15 79239648 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- ATAGTCACTGGGCCTGTCTG -3'
(R):5'- TATGCGCCACTATATGCCTTCG -3'

Sequencing Primer
(F):5'- ACTGGGCCTGTCTGCTCAC -3'
(R):5'- GCCACTATATGCCTTCGCTGTC -3'
Posted On 2017-02-10