Incidental Mutation 'R5869:Krt1'
ID454355
Institutional Source Beutler Lab
Gene Symbol Krt1
Ensembl Gene ENSMUSG00000046834
Gene Namekeratin 1
SynonymsKrt-2.1, Krt2-1
MMRRC Submission 044077-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.404) question?
Stock #R5869 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location101845426-101850794 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 101850131 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 199 (F199L)
Ref Sequence ENSEMBL: ENSMUSP00000023790 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023790]
Predicted Effect probably damaging
Transcript: ENSMUST00000023790
AA Change: F199L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000023790
Gene: ENSMUSG00000046834
AA Change: F199L

DomainStartEndE-ValueType
Pfam:Keratin_2_head 19 184 7.5e-35 PFAM
Filament 187 500 1.02e-154 SMART
Pfam:Keratin_2_tail 501 633 7.6e-29 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230798
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231047
Meta Mutation Damage Score 0.5441 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.1%
Validation Efficiency 93% (68/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the keratin gene family. The type II cytokeratins consist of basic or neutral proteins which are arranged in pairs of heterotypic keratin chains coexpressed during differentiation of simple and stratified epithelial tissues. This type II cytokeratin is specifically expressed in the spinous and granular layers of the epidermis with family member KRT10 and mutations in these genes have been associated with bullous congenital ichthyosiform erythroderma. The type II cytokeratins are clustered in a region of chromosome 12q12-q13. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice heterozygous for a dominant mutation exhibit significant blistering and skin erosions at birth and develop severe hyperkeratosis as adults. Mice homozygous for the dominant mutation also exhibit blistering, and die before weaning age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adarb1 T C 10: 77,325,616 probably benign Het
Arsk T C 13: 76,091,784 E100G probably benign Het
Ascc3 C T 10: 50,842,183 R1991* probably null Het
Aspscr1 T C 11: 120,688,920 I31T possibly damaging Het
Asz1 T C 6: 18,074,940 probably benign Het
Calm5 T A 13: 3,854,321 probably benign Het
Car5a G A 8: 121,916,380 T295I probably benign Het
Ccdc174 T A 6: 91,885,418 probably benign Het
Celsr2 G A 3: 108,413,909 A529V probably damaging Het
Cep192 A G 18: 67,815,864 D252G probably benign Het
Clcnka A G 4: 141,394,965 F217L probably benign Het
Cnot3 A T 7: 3,644,930 probably benign Het
Coro1c A G 5: 113,850,846 probably benign Het
Cstf3 A G 2: 104,659,240 probably null Het
Dcdc2a C T 13: 25,107,730 P233S probably benign Het
Ddx55 A G 5: 124,568,682 T581A probably benign Het
Exo1 T C 1: 175,901,283 S638P possibly damaging Het
Fam135a T C 1: 24,029,430 E616G possibly damaging Het
Fignl2 T C 15: 101,053,280 S374G unknown Het
Gm4799 A T 10: 82,954,449 noncoding transcript Het
Hectd4 T C 5: 121,343,225 probably null Het
Ighv1-76 T C 12: 115,848,038 E65G probably damaging Het
Igsf9b C A 9: 27,323,235 H465Q probably benign Het
Itga9 A G 9: 118,663,889 D284G probably damaging Het
Itpr1 T C 6: 108,473,529 S1940P probably benign Het
Kcnb1 A G 2: 167,188,071 S185P probably benign Het
Kif20a G A 18: 34,632,415 A822T probably benign Het
Lpin2 A G 17: 71,232,276 probably benign Het
Lrp1b A C 2: 41,004,603 D2204E probably damaging Het
Mier3 T A 13: 111,714,850 N427K probably damaging Het
Mmp12 GTAATAATAATAATAATAAT GTAATAATAATAATAAT 9: 7,348,446 probably benign Het
Mroh3 T A 1: 136,186,123 M643L probably benign Het
Myh11 A G 16: 14,230,800 S548P probably damaging Het
Nat8f6 A C 6: 85,808,523 L215V possibly damaging Het
Nlrp3 G A 11: 59,548,134 R179Q probably damaging Het
Nup88 T C 11: 70,969,671 E94G probably benign Het
Pias1 A T 9: 62,912,766 D306E probably benign Het
Pick1 A G 15: 79,248,895 D385G probably benign Het
Pitx3 A T 19: 46,137,296 probably benign Het
Plpp3 T A 4: 105,194,962 probably null Het
Prlhr C A 19: 60,467,621 R169L probably damaging Het
Ptprf A C 4: 118,210,382 M1872R probably damaging Het
Ptprh T C 7: 4,601,940 D35G probably benign Het
Rnf130 A G 11: 50,085,815 probably null Het
Rnf17 A C 14: 56,505,988 E1337A possibly damaging Het
Sdk2 A G 11: 113,851,882 Y734H probably damaging Het
Slc25a10 C T 11: 120,498,117 T269I probably damaging Het
Slc4a11 A C 2: 130,684,459 V855G probably benign Het
Slc5a5 C A 8: 70,892,330 R111L probably damaging Het
Spg20 A T 3: 55,135,510 M616L probably benign Het
Tmem229a T C 6: 24,954,687 D356G probably damaging Het
Tmem30c A G 16: 57,266,562 S293P probably damaging Het
Tnfrsf14 C A 4: 154,926,598 probably null Het
Tnfrsf19 C T 14: 60,971,178 R298H possibly damaging Het
Ttc21a A G 9: 119,958,792 K809E probably benign Het
Ttn G A 2: 76,750,209 P23447S probably damaging Het
Uap1 T A 1: 170,151,138 probably null Het
Wdr82 A G 9: 106,185,304 Q252R probably benign Het
Zfp523 T C 17: 28,194,993 I34T probably benign Het
Zfp808 T A 13: 62,171,255 H99Q probably damaging Het
Other mutations in Krt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01133:Krt1 APN 15 101848193 missense probably damaging 1.00
IGL01478:Krt1 APN 15 101846286 splice site probably benign
IGL01919:Krt1 APN 15 101846376 missense unknown
IGL01970:Krt1 APN 15 101846864 missense possibly damaging 0.95
IGL02207:Krt1 APN 15 101848616 missense possibly damaging 0.94
IGL02643:Krt1 APN 15 101847044 missense probably benign 0.26
R0445:Krt1 UTSW 15 101847621 missense probably damaging 1.00
R0683:Krt1 UTSW 15 101850466 missense unknown
R1006:Krt1 UTSW 15 101847891 missense possibly damaging 0.96
R1163:Krt1 UTSW 15 101848165 nonsense probably null
R1217:Krt1 UTSW 15 101848981 missense possibly damaging 0.90
R1325:Krt1 UTSW 15 101848206 splice site probably null
R1965:Krt1 UTSW 15 101848992 missense probably benign 0.13
R1966:Krt1 UTSW 15 101848992 missense probably benign 0.13
R2101:Krt1 UTSW 15 101846187 missense unknown
R2302:Krt1 UTSW 15 101846187 missense unknown
R2697:Krt1 UTSW 15 101846929 missense probably damaging 1.00
R3034:Krt1 UTSW 15 101850633 missense unknown
R3079:Krt1 UTSW 15 101846187 missense unknown
R3080:Krt1 UTSW 15 101846187 missense unknown
R3891:Krt1 UTSW 15 101850412 missense unknown
R3892:Krt1 UTSW 15 101850412 missense unknown
R4180:Krt1 UTSW 15 101850378 small deletion probably benign
R4305:Krt1 UTSW 15 101850378 small deletion probably benign
R4334:Krt1 UTSW 15 101850378 small deletion probably benign
R4597:Krt1 UTSW 15 101847628 missense possibly damaging 0.90
R4625:Krt1 UTSW 15 101846187 missense unknown
R4626:Krt1 UTSW 15 101846187 missense unknown
R4628:Krt1 UTSW 15 101846187 missense unknown
R4629:Krt1 UTSW 15 101846187 missense unknown
R4630:Krt1 UTSW 15 101846187 missense unknown
R4631:Krt1 UTSW 15 101846187 missense unknown
R4632:Krt1 UTSW 15 101846187 missense unknown
R4633:Krt1 UTSW 15 101846187 missense unknown
R4893:Krt1 UTSW 15 101850120 missense probably damaging 1.00
R4948:Krt1 UTSW 15 101845941 missense unknown
R5193:Krt1 UTSW 15 101845922 missense unknown
R5254:Krt1 UTSW 15 101846368 missense unknown
R5448:Krt1 UTSW 15 101849029 nonsense probably null
R5494:Krt1 UTSW 15 101850714 missense unknown
R5567:Krt1 UTSW 15 101846905 missense probably benign 0.12
R5570:Krt1 UTSW 15 101846905 missense probably benign 0.12
R6200:Krt1 UTSW 15 101850378 small deletion probably benign
R6224:Krt1 UTSW 15 101850267 missense possibly damaging 0.92
R6326:Krt1 UTSW 15 101850249 missense probably damaging 1.00
R6517:Krt1 UTSW 15 101850267 missense possibly damaging 0.92
R6525:Krt1 UTSW 15 101850378 small deletion probably benign
R6918:Krt1 UTSW 15 101850177 missense probably damaging 1.00
R7018:Krt1 UTSW 15 101850378 small deletion probably benign
R7040:Krt1 UTSW 15 101850378 small deletion probably benign
R7110:Krt1 UTSW 15 101850378 small deletion probably benign
R7296:Krt1 UTSW 15 101850629 missense unknown
R7368:Krt1 UTSW 15 101846872 missense probably damaging 1.00
R7549:Krt1 UTSW 15 101850378 small deletion probably benign
R7706:Krt1 UTSW 15 101850378 small deletion probably benign
R8416:Krt1 UTSW 15 101850378 small deletion probably benign
R8418:Krt1 UTSW 15 101850378 small deletion probably benign
RF003:Krt1 UTSW 15 101850378 small deletion probably benign
X0067:Krt1 UTSW 15 101847755 critical splice donor site probably null
Z1177:Krt1 UTSW 15 101846016 missense unknown
Z1177:Krt1 UTSW 15 101850535 missense unknown
Predicted Primers PCR Primer
(F):5'- GCATCACTCCTGAGAAGACTTTTAG -3'
(R):5'- TATGAACCTTGGAGGCGGTAG -3'

Sequencing Primer
(F):5'- CTGAGAAGACTTTTAGCATATGTCCC -3'
(R):5'- AGCATCTCCAAGAGTGTGGCTG -3'
Posted On2017-02-10