Mutagenetix > Incidental Mutations

Incidental Mutation 'R5869:Myh11'

454356

Institutional Source

Beutler Lab

Gene Symbol

Myh11

Ensembl Gene

ENSMUSG00000018830

Gene Name

myosin, heavy polypeptide 11, smooth muscle

Synonyms

smMHC, SM1, SM2

MMRRC Submission

044077-MU

Accession Numbers

Genbank: NM_013607, NM_001161775

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R5869 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

14194535-14291372 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 14230800 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 548 (S548P)

Ref Sequence

ENSEMBL: ENSMUSP00000155052 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000090287] [ENSMUST00000230397] [ENSMUST00000231567]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000090287
AA Change: S548P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000087756
Gene: ENSMUSG00000018830
AA Change: S548P

Domain	Start	End	E-Value	Type
Pfam:Myosin_N	33	73	1e-15	PFAM
MYSc	79	784	N/A	SMART
IQ	785	807	1.09e-2	SMART
Pfam:Myosin_tail_1	848	1928	N/A	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000230397
AA Change: S548P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

Predicted Effect

probably damaging
Transcript: ENSMUST00000231567
AA Change: S555P

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

Meta Mutation Damage Score

0.9143

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.5%
20x: 92.1%

Validation Efficiency

93% (68/73)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a smooth muscle myosin belonging to the myosin heavy chain family. The gene product is a subunit of a hexameric protein that consists of two heavy chain subunits and two pairs of non-identical light chain subunits. It functions as a major contractile protein, converting chemical energy into mechanical energy through the hydrolysis of ATP. The gene encoding a human ortholog of rat NUDE1 is transcribed from the reverse strand of this gene, and its 3' end overlaps with that of the latter. The pericentric inversion of chromosome 16 [inv(16)(p13q22)] produces a chimeric transcript that encodes a protein consisting of the first 165 residues from the N terminus of core-binding factor beta in a fusion with the C-terminal portion of the smooth muscle myosin heavy chain. This chromosomal rearrangement is associated with acute myeloid leukemia of the M4Eo subtype. Alternative splicing generates isoforms that are differentially expressed, with ratios changing during muscle cell maturation. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice have impaired smooth muscle contractility. They are incapable of urinating, exhibit dilative cardiomyopathy, are growth retarded, and die within 3 days of birth. [provided by MGI curators]

Allele List at MGI

All alleles(4) : Targeted, knock-out(4)

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adarb1	T	C	10: 77,325,616		probably benign	Het
Arsk	T	C	13: 76,091,784	E100G	probably benign	Het
Ascc3	C	T	10: 50,842,183	R1991*	probably null	Het
Aspscr1	T	C	11: 120,688,920	I31T	possibly damaging	Het
Asz1	T	C	6: 18,074,940		probably benign	Het
Calm5	T	A	13: 3,854,321		probably benign	Het
Car5a	G	A	8: 121,916,380	T295I	probably benign	Het
Ccdc174	T	A	6: 91,885,418		probably benign	Het
Celsr2	G	A	3: 108,413,909	A529V	probably damaging	Het
Cep192	A	G	18: 67,815,864	D252G	probably benign	Het
Clcnka	A	G	4: 141,394,965	F217L	probably benign	Het
Cnot3	A	T	7: 3,644,930		probably benign	Het
Coro1c	A	G	5: 113,850,846		probably benign	Het
Cstf3	A	G	2: 104,659,240		probably null	Het
Dcdc2a	C	T	13: 25,107,730	P233S	probably benign	Het
Ddx55	A	G	5: 124,568,682	T581A	probably benign	Het
Exo1	T	C	1: 175,901,283	S638P	possibly damaging	Het
Fam135a	T	C	1: 24,029,430	E616G	possibly damaging	Het
Fignl2	T	C	15: 101,053,280	S374G	unknown	Het
Gm4799	A	T	10: 82,954,449		noncoding transcript	Het
Hectd4	T	C	5: 121,343,225		probably null	Het
Ighv1-76	T	C	12: 115,848,038	E65G	probably damaging	Het
Igsf9b	C	A	9: 27,323,235	H465Q	probably benign	Het
Itga9	A	G	9: 118,663,889	D284G	probably damaging	Het
Itpr1	T	C	6: 108,473,529	S1940P	probably benign	Het
Kcnb1	A	G	2: 167,188,071	S185P	probably benign	Het
Kif20a	G	A	18: 34,632,415	A822T	probably benign	Het
Krt1	A	T	15: 101,850,131	F199L	probably damaging	Het
Lpin2	A	G	17: 71,232,276		probably benign	Het
Lrp1b	A	C	2: 41,004,603	D2204E	probably damaging	Het
Mier3	T	A	13: 111,714,850	N427K	probably damaging	Het
Mmp12	GTAATAATAATAATAATAAT	GTAATAATAATAATAAT	9: 7,348,446		probably benign	Het
Mroh3	T	A	1: 136,186,123	M643L	probably benign	Het
Nat8f6	A	C	6: 85,808,523	L215V	possibly damaging	Het
Nlrp3	G	A	11: 59,548,134	R179Q	probably damaging	Het
Nup88	T	C	11: 70,969,671	E94G	probably benign	Het
Pias1	A	T	9: 62,912,766	D306E	probably benign	Het
Pick1	A	G	15: 79,248,895	D385G	probably benign	Het
Pitx3	A	T	19: 46,137,296		probably benign	Het
Plpp3	T	A	4: 105,194,962		probably null	Het
Prlhr	C	A	19: 60,467,621	R169L	probably damaging	Het
Ptprf	A	C	4: 118,210,382	M1872R	probably damaging	Het
Ptprh	T	C	7: 4,601,940	D35G	probably benign	Het
Rnf130	A	G	11: 50,085,815		probably null	Het
Rnf17	A	C	14: 56,505,988	E1337A	possibly damaging	Het
Sdk2	A	G	11: 113,851,882	Y734H	probably damaging	Het
Slc25a10	C	T	11: 120,498,117	T269I	probably damaging	Het
Slc4a11	A	C	2: 130,684,459	V855G	probably benign	Het
Slc5a5	C	A	8: 70,892,330	R111L	probably damaging	Het
Spg20	A	T	3: 55,135,510	M616L	probably benign	Het
Tmem229a	T	C	6: 24,954,687	D356G	probably damaging	Het
Tmem30c	A	G	16: 57,266,562	S293P	probably damaging	Het
Tnfrsf14	C	A	4: 154,926,598		probably null	Het
Tnfrsf19	C	T	14: 60,971,178	R298H	possibly damaging	Het
Ttc21a	A	G	9: 119,958,792	K809E	probably benign	Het
Ttn	G	A	2: 76,750,209	P23447S	probably damaging	Het
Uap1	T	A	1: 170,151,138		probably null	Het
Wdr82	A	G	9: 106,185,304	Q252R	probably benign	Het
Zfp523	T	C	17: 28,194,993	I34T	probably benign	Het
Zfp808	T	A	13: 62,171,255	H99Q	probably damaging	Het

Other mutations in Myh11

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01362:Myh11	APN	16	14277722	missense	probably benign	0.00
IGL01398:Myh11	APN	16	14202100	missense	probably damaging	0.99
IGL01646:Myh11	APN	16	14221775	missense	probably damaging	1.00
IGL02470:Myh11	APN	16	14218046	missense	probably damaging	1.00
IGL02680:Myh11	APN	16	14209520	missense	probably benign	0.02
IGL02687:Myh11	APN	16	14212618	nonsense	probably null
IGL02987:Myh11	APN	16	14232532	missense	probably damaging	1.00
IGL03008:Myh11	APN	16	14204753	missense	probably benign	0.00
G5030:Myh11	UTSW	16	14250579	missense	probably damaging	1.00
PIT4618001:Myh11	UTSW	16	14201066	missense
R0008:Myh11	UTSW	16	14224019	missense	probably damaging	1.00
R0085:Myh11	UTSW	16	14224019	missense	probably damaging	1.00
R0086:Myh11	UTSW	16	14224019	missense	probably damaging	1.00
R0087:Myh11	UTSW	16	14224019	missense	probably damaging	1.00
R0096:Myh11	UTSW	16	14204367	missense	possibly damaging	0.94
R0096:Myh11	UTSW	16	14204367	missense	possibly damaging	0.94
R0207:Myh11	UTSW	16	14211260	missense	possibly damaging	0.95
R0326:Myh11	UTSW	16	14218880	missense	probably benign	0.32
R0546:Myh11	UTSW	16	14205628	missense	probably damaging	1.00
R0658:Myh11	UTSW	16	14224019	missense	probably damaging	1.00
R0715:Myh11	UTSW	16	14226616	missense	possibly damaging	0.89
R0839:Myh11	UTSW	16	14203178	missense	probably damaging	1.00
R1014:Myh11	UTSW	16	14236410	missense	possibly damaging	0.70
R1104:Myh11	UTSW	16	14202127	missense	possibly damaging	0.53
R1426:Myh11	UTSW	16	14205931	nonsense	probably null
R1560:Myh11	UTSW	16	14226620	nonsense	probably null
R1714:Myh11	UTSW	16	14236368	critical splice donor site	probably null
R1742:Myh11	UTSW	16	14220044	missense	probably damaging	1.00
R1750:Myh11	UTSW	16	14200758	missense	probably damaging	1.00
R1750:Myh11	UTSW	16	14215790	missense	probably damaging	0.98
R1753:Myh11	UTSW	16	14277870	missense	probably benign
R1760:Myh11	UTSW	16	14233695	splice site	probably benign
R1829:Myh11	UTSW	16	14223880	missense	probably damaging	1.00
R1876:Myh11	UTSW	16	14269103	splice site	probably benign
R2027:Myh11	UTSW	16	14232668	missense	probably damaging	1.00
R2122:Myh11	UTSW	16	14218004	missense	probably damaging	1.00
R2247:Myh11	UTSW	16	14277559	missense	probably damaging	1.00
R2495:Myh11	UTSW	16	14205557	missense	probably damaging	1.00
R2863:Myh11	UTSW	16	14239426	missense	probably benign	0.02
R3684:Myh11	UTSW	16	14203234	missense	probably benign	0.00
R3693:Myh11	UTSW	16	14217949	missense	probably benign	0.01
R4080:Myh11	UTSW	16	14224059	missense	possibly damaging	0.83
R4367:Myh11	UTSW	16	14218883	missense	probably damaging	0.97
R4664:Myh11	UTSW	16	14226584	missense	possibly damaging	0.70
R4673:Myh11	UTSW	16	14269241	missense	probably damaging	0.99
R4694:Myh11	UTSW	16	14200702	missense	probably damaging	1.00
R4805:Myh11	UTSW	16	14234465	missense	possibly damaging	0.61
R4806:Myh11	UTSW	16	14201083	splice site	probably null
R4905:Myh11	UTSW	16	14250523	missense	probably benign	0.13
R4939:Myh11	UTSW	16	14239507	missense	probably benign
R4964:Myh11	UTSW	16	14205954	missense	probably damaging	1.00
R4966:Myh11	UTSW	16	14205954	missense	probably damaging	1.00
R5029:Myh11	UTSW	16	14205625	missense	probably damaging	1.00
R5045:Myh11	UTSW	16	14239527	nonsense	probably null
R5097:Myh11	UTSW	16	14205906	splice site	probably null
R5288:Myh11	UTSW	16	14208008	missense	possibly damaging	0.66
R5385:Myh11	UTSW	16	14208008	missense	possibly damaging	0.66
R5621:Myh11	UTSW	16	14244855	missense	probably damaging	0.96
R5856:Myh11	UTSW	16	14205976	missense	probably benign	0.00
R6019:Myh11	UTSW	16	14206074	missense	probably damaging	1.00
R6024:Myh11	UTSW	16	14277703	missense	probably damaging	0.99
R6139:Myh11	UTSW	16	14215874	missense	probably damaging	1.00
R6209:Myh11	UTSW	16	14208291	nonsense	probably null
R6373:Myh11	UTSW	16	14205130	missense	possibly damaging	0.72
R6671:Myh11	UTSW	16	14226616	missense	possibly damaging	0.89
R6688:Myh11	UTSW	16	14205553	missense	probably damaging	1.00
R6709:Myh11	UTSW	16	14223494	critical splice donor site	probably null
R7069:Myh11	UTSW	16	14218939	missense	possibly damaging	0.95
R7176:Myh11	UTSW	16	14215826	missense
R7644:Myh11	UTSW	16	14221824	missense
R7838:Myh11	UTSW	16	14209617	missense
R7905:Myh11	UTSW	16	14207681	nonsense	probably null
R8261:Myh11	UTSW	16	14224003	missense
R8272:Myh11	UTSW	16	14218854	missense
R8317:Myh11	UTSW	16	14208077	missense
R8359:Myh11	UTSW	16	14208231	critical splice donor site	probably null
R8486:Myh11	UTSW	16	14204668	missense	possibly damaging	0.77
R8527:Myh11	UTSW	16	14230706	missense	probably damaging	1.00
R8861:Myh11	UTSW	16	14246782	missense
R8886:Myh11	UTSW	16	14234414	missense
R8946:Myh11	UTSW	16	14230716	missense	probably benign	0.08
R9151:Myh11	UTSW	16	14232575	missense
R9253:Myh11	UTSW	16	14256495	missense
R9257:Myh11	UTSW	16	14269256	missense
R9273:Myh11	UTSW	16	14236419	missense
R9320:Myh11	UTSW	16	14211288	missense
R9364:Myh11	UTSW	16	14200716	missense
R9365:Myh11	UTSW	16	14234433	missense
X0018:Myh11	UTSW	16	14277633	missense	probably damaging	1.00
X0025:Myh11	UTSW	16	14209689	missense	possibly damaging	0.93
X0027:Myh11	UTSW	16	14234402	missense	probably damaging	1.00
Z1088:Myh11	UTSW	16	14269262	frame shift	probably null
Z1176:Myh11	UTSW	16	14239396	missense	probably null
Z1176:Myh11	UTSW	16	14277775	missense
Z1177:Myh11	UTSW	16	14209595	missense

Predicted Primers

PCR Primer
(F):5'- AACCACCTTGCTACAAGTGTTTGG -3'
(R):5'- CTCCCACATGTCAAGGCTTC -3'

Sequencing Primer
(F):5'- TTTGGAGGGTACAGCCACTGC -3'
(R):5'- GCTTCAGCCCTGTGCCAC -3'

Posted On

2017-02-10