Incidental Mutation 'R5869:Lpin2'
ID 454359
Institutional Source Beutler Lab
Gene Symbol Lpin2
Ensembl Gene ENSMUSG00000024052
Gene Name lipin 2
Synonyms 2610511G02Rik
MMRRC Submission 044077-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.321) question?
Stock # R5869 (G1)
Quality Score 225
Status Validated
Chromosome 17
Chromosomal Location 71182560-71249817 bp(+) (GRCm38)
Type of Mutation unclassified
DNA Base Change (assembly) A to G at 71232276 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000115061 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000126681] [ENSMUST00000129635] [ENSMUST00000135589] [ENSMUST00000156570]
AlphaFold Q99PI5
Predicted Effect probably benign
Transcript: ENSMUST00000126681
SMART Domains Protein: ENSMUSP00000118610
Gene: ENSMUSG00000024052

DomainStartEndE-ValueType
Pfam:Lipin_N 39 148 1e-47 PFAM
low complexity region 191 206 N/A INTRINSIC
low complexity region 217 227 N/A INTRINSIC
low complexity region 398 420 N/A INTRINSIC
Pfam:Lipin_mid 504 596 6.1e-37 PFAM
LNS2 720 876 2.18e-107 SMART
low complexity region 924 930 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000129635
SMART Domains Protein: ENSMUSP00000119282
Gene: ENSMUSG00000024052

DomainStartEndE-ValueType
Pfam:Lipin_N 1 114 2.2e-53 PFAM
low complexity region 153 168 N/A INTRINSIC
low complexity region 179 189 N/A INTRINSIC
low complexity region 360 382 N/A INTRINSIC
LNS2 682 838 2.18e-107 SMART
low complexity region 886 892 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130750
Predicted Effect probably benign
Transcript: ENSMUST00000135589
SMART Domains Protein: ENSMUSP00000115061
Gene: ENSMUSG00000024052

DomainStartEndE-ValueType
Pfam:Lipin_N 39 152 2.3e-54 PFAM
low complexity region 191 206 N/A INTRINSIC
low complexity region 217 227 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142842
Predicted Effect unknown
Transcript: ENSMUST00000156570
AA Change: N453S
SMART Domains Protein: ENSMUSP00000120634
Gene: ENSMUSG00000024052
AA Change: N453S

DomainStartEndE-ValueType
Pfam:Lipin_N 1 114 8.5e-54 PFAM
low complexity region 153 168 N/A INTRINSIC
low complexity region 179 189 N/A INTRINSIC
low complexity region 360 382 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180743
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.1%
Validation Efficiency 93% (68/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mouse studies suggest that this gene functions during normal adipose tissue development and may play a role in human triglyceride metabolism. This gene represents a candidate gene for human lipodystrophy, characterized by loss of body fat, fatty liver, hypertriglyceridemia, and insulin resistance. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice develop ataxia, impaired blance, and tremors with age and show altered cerebellar phospholipid composition and anemia. Mice show diet-induced hepatic triglyceride accumulation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adarb1 T C 10: 77,325,616 probably benign Het
Arsk T C 13: 76,091,784 E100G probably benign Het
Ascc3 C T 10: 50,842,183 R1991* probably null Het
Aspscr1 T C 11: 120,688,920 I31T possibly damaging Het
Asz1 T C 6: 18,074,940 probably benign Het
Calm5 T A 13: 3,854,321 probably benign Het
Car5a G A 8: 121,916,380 T295I probably benign Het
Ccdc174 T A 6: 91,885,418 probably benign Het
Celsr2 G A 3: 108,413,909 A529V probably damaging Het
Cep192 A G 18: 67,815,864 D252G probably benign Het
Clcnka A G 4: 141,394,965 F217L probably benign Het
Cnot3 A T 7: 3,644,930 probably benign Het
Coro1c A G 5: 113,850,846 probably benign Het
Cstf3 A G 2: 104,659,240 probably null Het
Dcdc2a C T 13: 25,107,730 P233S probably benign Het
Ddx55 A G 5: 124,568,682 T581A probably benign Het
Exo1 T C 1: 175,901,283 S638P possibly damaging Het
Fam135a T C 1: 24,029,430 E616G possibly damaging Het
Fignl2 T C 15: 101,053,280 S374G unknown Het
Gm4799 A T 10: 82,954,449 noncoding transcript Het
Hectd4 T C 5: 121,343,225 probably null Het
Ighv1-76 T C 12: 115,848,038 E65G probably damaging Het
Igsf9b C A 9: 27,323,235 H465Q probably benign Het
Itga9 A G 9: 118,663,889 D284G probably damaging Het
Itpr1 T C 6: 108,473,529 S1940P probably benign Het
Kcnb1 A G 2: 167,188,071 S185P probably benign Het
Kif20a G A 18: 34,632,415 A822T probably benign Het
Krt1 A T 15: 101,850,131 F199L probably damaging Het
Lrp1b A C 2: 41,004,603 D2204E probably damaging Het
Mier3 T A 13: 111,714,850 N427K probably damaging Het
Mmp12 GTAATAATAATAATAATAAT GTAATAATAATAATAAT 9: 7,348,446 probably benign Het
Mroh3 T A 1: 136,186,123 M643L probably benign Het
Myh11 A G 16: 14,230,800 S548P probably damaging Het
Nat8f6 A C 6: 85,808,523 L215V possibly damaging Het
Nlrp3 G A 11: 59,548,134 R179Q probably damaging Het
Nup88 T C 11: 70,969,671 E94G probably benign Het
Pias1 A T 9: 62,912,766 D306E probably benign Het
Pick1 A G 15: 79,248,895 D385G probably benign Het
Pitx3 A T 19: 46,137,296 probably benign Het
Plpp3 T A 4: 105,194,962 probably null Het
Prlhr C A 19: 60,467,621 R169L probably damaging Het
Ptprf A C 4: 118,210,382 M1872R probably damaging Het
Ptprh T C 7: 4,601,940 D35G probably benign Het
Rnf130 A G 11: 50,085,815 probably null Het
Rnf17 A C 14: 56,505,988 E1337A possibly damaging Het
Sdk2 A G 11: 113,851,882 Y734H probably damaging Het
Slc25a10 C T 11: 120,498,117 T269I probably damaging Het
Slc4a11 A C 2: 130,684,459 V855G probably benign Het
Slc5a5 C A 8: 70,892,330 R111L probably damaging Het
Spg20 A T 3: 55,135,510 M616L probably benign Het
Tmem229a T C 6: 24,954,687 D356G probably damaging Het
Tmem30c A G 16: 57,266,562 S293P probably damaging Het
Tnfrsf14 C A 4: 154,926,598 probably null Het
Tnfrsf19 C T 14: 60,971,178 R298H possibly damaging Het
Ttc21a A G 9: 119,958,792 K809E probably benign Het
Ttn G A 2: 76,750,209 P23447S probably damaging Het
Uap1 T A 1: 170,151,138 probably null Het
Wdr82 A G 9: 106,185,304 Q252R probably benign Het
Zfp523 T C 17: 28,194,993 I34T probably benign Het
Zfp808 T A 13: 62,171,255 H99Q probably damaging Het
Other mutations in Lpin2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00333:Lpin2 APN 17 71243972 missense probably damaging 1.00
IGL01712:Lpin2 APN 17 71215068 missense probably damaging 1.00
IGL01727:Lpin2 APN 17 71246452 missense probably damaging 1.00
IGL01969:Lpin2 APN 17 71231507 missense probably benign 0.00
IGL02143:Lpin2 APN 17 71243926 missense probably damaging 1.00
IGL02600:Lpin2 APN 17 71238698 missense probably damaging 0.99
IGL02931:Lpin2 APN 17 71238683 missense probably damaging 1.00
aspen UTSW 17 71243970 nonsense probably null
R1570_Lpin2_218 UTSW 17 71245181 nonsense probably null
R0144:Lpin2 UTSW 17 71225076 missense probably damaging 1.00
R0165:Lpin2 UTSW 17 71246519 missense probably damaging 1.00
R0367:Lpin2 UTSW 17 71215022 missense probably damaging 1.00
R0648:Lpin2 UTSW 17 71229312 missense probably benign 0.01
R1564:Lpin2 UTSW 17 71225060 missense probably benign 0.01
R1570:Lpin2 UTSW 17 71245181 nonsense probably null
R1846:Lpin2 UTSW 17 71225069 missense probably benign 0.00
R3607:Lpin2 UTSW 17 71229392 missense probably damaging 1.00
R4006:Lpin2 UTSW 17 71246501 missense probably damaging 1.00
R4526:Lpin2 UTSW 17 71237378 splice site probably null
R4705:Lpin2 UTSW 17 71232143 unclassified probably benign
R4949:Lpin2 UTSW 17 71231339 missense probably damaging 1.00
R4970:Lpin2 UTSW 17 71231334 missense probably damaging 0.98
R5099:Lpin2 UTSW 17 71243970 nonsense probably null
R5100:Lpin2 UTSW 17 71243970 nonsense probably null
R5101:Lpin2 UTSW 17 71243970 nonsense probably null
R5152:Lpin2 UTSW 17 71245159 missense probably damaging 1.00
R5216:Lpin2 UTSW 17 71242760 missense probably damaging 1.00
R5321:Lpin2 UTSW 17 71246858 missense probably damaging 1.00
R5457:Lpin2 UTSW 17 71243372 missense probably damaging 1.00
R5695:Lpin2 UTSW 17 71244803 missense probably damaging 1.00
R5786:Lpin2 UTSW 17 71230273 missense probably benign 0.03
R5894:Lpin2 UTSW 17 71246934 missense probably benign 0.39
R6116:Lpin2 UTSW 17 71243930 missense probably damaging 1.00
R6253:Lpin2 UTSW 17 71231269 missense probably damaging 1.00
R6280:Lpin2 UTSW 17 71232248 unclassified probably benign
R6443:Lpin2 UTSW 17 71241668 missense probably benign 0.25
R6528:Lpin2 UTSW 17 71244005 missense probably damaging 1.00
R6634:Lpin2 UTSW 17 71246418 missense probably damaging 1.00
R6828:Lpin2 UTSW 17 71222128 missense probably damaging 1.00
R6885:Lpin2 UTSW 17 71215150 missense probably damaging 1.00
R6930:Lpin2 UTSW 17 71244791 missense probably damaging 1.00
R7067:Lpin2 UTSW 17 71244858 missense possibly damaging 0.72
R7583:Lpin2 UTSW 17 71231396 nonsense probably null
R7806:Lpin2 UTSW 17 71245171 missense probably damaging 1.00
R7840:Lpin2 UTSW 17 71230274 missense probably benign 0.14
R8011:Lpin2 UTSW 17 71230375 missense probably benign 0.43
R8553:Lpin2 UTSW 17 71231237 missense probably damaging 1.00
R8879:Lpin2 UTSW 17 71242754 missense probably damaging 1.00
R8947:Lpin2 UTSW 17 71204876 missense probably benign 0.44
R8983:Lpin2 UTSW 17 71246967 missense unknown
R9109:Lpin2 UTSW 17 71231521 critical splice donor site probably null
R9184:Lpin2 UTSW 17 71233916 nonsense probably null
R9242:Lpin2 UTSW 17 71246971 makesense probably null
Z1176:Lpin2 UTSW 17 71225211 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CTCAGACCTCTGCTTAGCTGAAG -3'
(R):5'- TCACTGGGTAACTGTGTGTC -3'

Sequencing Primer
(F):5'- TTGAAGAACAACTGTCTACTAGGG -3'
(R):5'- CTGTGTGTCTTTTAGCAACAAGC -3'
Posted On 2017-02-10