Incidental Mutation 'R5869:Kif20a'
ID454360
Institutional Source Beutler Lab
Gene Symbol Kif20a
Ensembl Gene ENSMUSG00000003779
Gene Namekinesin family member 20A
SynonymsRabkinesin-6, Rab6kifl
MMRRC Submission 044077-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5869 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location34624624-34633265 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 34632415 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 822 (A822T)
Ref Sequence ENSEMBL: ENSMUSP00000130045 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025228] [ENSMUST00000133181] [ENSMUST00000166044] [ENSMUST00000167161]
Predicted Effect probably benign
Transcript: ENSMUST00000025228
SMART Domains Protein: ENSMUSP00000025228
Gene: ENSMUSG00000024370

DomainStartEndE-ValueType
Pfam:APC8 22 152 1.9e-42 PFAM
Blast:TPR 175 202 4e-10 BLAST
TPR 263 296 4.21e1 SMART
TPR 331 364 1.74e-4 SMART
TPR 365 398 1.83e-3 SMART
TPR 399 432 1.37e-2 SMART
TPR 433 466 8.97e0 SMART
TPR 510 543 1.82e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133162
Predicted Effect probably benign
Transcript: ENSMUST00000133181
SMART Domains Protein: ENSMUSP00000122420
Gene: ENSMUSG00000024370

DomainStartEndE-ValueType
low complexity region 2 24 N/A INTRINSIC
Pfam:ANAPC8 28 151 6.9e-31 PFAM
Blast:TPR 175 202 4e-10 BLAST
TPR 263 296 4.21e1 SMART
TPR 331 364 1.74e-4 SMART
TPR 365 398 1.83e-3 SMART
TPR 399 432 1.37e-2 SMART
TPR 433 466 8.97e0 SMART
TPR 510 543 1.82e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136949
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138400
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155307
Predicted Effect probably benign
Transcript: ENSMUST00000166044
AA Change: A822T

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000132659
Gene: ENSMUSG00000003779
AA Change: A822T

DomainStartEndE-ValueType
KISc 61 514 3.95e-141 SMART
coiled coil region 559 760 N/A INTRINSIC
low complexity region 831 842 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000167161
AA Change: A822T

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000130045
Gene: ENSMUSG00000003779
AA Change: A822T

DomainStartEndE-ValueType
KISc 61 514 3.95e-141 SMART
coiled coil region 559 760 N/A INTRINSIC
low complexity region 831 842 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.1%
Validation Efficiency 93% (68/73)
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adarb1 T C 10: 77,325,616 probably benign Het
Arsk T C 13: 76,091,784 E100G probably benign Het
Ascc3 C T 10: 50,842,183 R1991* probably null Het
Aspscr1 T C 11: 120,688,920 I31T possibly damaging Het
Asz1 T C 6: 18,074,940 probably benign Het
Calm5 T A 13: 3,854,321 probably benign Het
Car5a G A 8: 121,916,380 T295I probably benign Het
Ccdc174 T A 6: 91,885,418 probably benign Het
Celsr2 G A 3: 108,413,909 A529V probably damaging Het
Cep192 A G 18: 67,815,864 D252G probably benign Het
Clcnka A G 4: 141,394,965 F217L probably benign Het
Cnot3 A T 7: 3,644,930 probably benign Het
Coro1c A G 5: 113,850,846 probably benign Het
Cstf3 A G 2: 104,659,240 probably null Het
Dcdc2a C T 13: 25,107,730 P233S probably benign Het
Ddx55 A G 5: 124,568,682 T581A probably benign Het
Exo1 T C 1: 175,901,283 S638P possibly damaging Het
Fam135a T C 1: 24,029,430 E616G possibly damaging Het
Fignl2 T C 15: 101,053,280 S374G unknown Het
Gm4799 A T 10: 82,954,449 noncoding transcript Het
Hectd4 T C 5: 121,343,225 probably null Het
Ighv1-76 T C 12: 115,848,038 E65G probably damaging Het
Igsf9b C A 9: 27,323,235 H465Q probably benign Het
Itga9 A G 9: 118,663,889 D284G probably damaging Het
Itpr1 T C 6: 108,473,529 S1940P probably benign Het
Kcnb1 A G 2: 167,188,071 S185P probably benign Het
Krt1 A T 15: 101,850,131 F199L probably damaging Het
Lpin2 A G 17: 71,232,276 probably benign Het
Lrp1b A C 2: 41,004,603 D2204E probably damaging Het
Mier3 T A 13: 111,714,850 N427K probably damaging Het
Mmp12 GTAATAATAATAATAATAAT GTAATAATAATAATAAT 9: 7,348,446 probably benign Het
Mroh3 T A 1: 136,186,123 M643L probably benign Het
Myh11 A G 16: 14,230,800 S548P probably damaging Het
Nat8f6 A C 6: 85,808,523 L215V possibly damaging Het
Nlrp3 G A 11: 59,548,134 R179Q probably damaging Het
Nup88 T C 11: 70,969,671 E94G probably benign Het
Pias1 A T 9: 62,912,766 D306E probably benign Het
Pick1 A G 15: 79,248,895 D385G probably benign Het
Pitx3 A T 19: 46,137,296 probably benign Het
Plpp3 T A 4: 105,194,962 probably null Het
Prlhr C A 19: 60,467,621 R169L probably damaging Het
Ptprf A C 4: 118,210,382 M1872R probably damaging Het
Ptprh T C 7: 4,601,940 D35G probably benign Het
Rnf130 A G 11: 50,085,815 probably null Het
Rnf17 A C 14: 56,505,988 E1337A possibly damaging Het
Sdk2 A G 11: 113,851,882 Y734H probably damaging Het
Slc25a10 C T 11: 120,498,117 T269I probably damaging Het
Slc4a11 A C 2: 130,684,459 V855G probably benign Het
Slc5a5 C A 8: 70,892,330 R111L probably damaging Het
Spg20 A T 3: 55,135,510 M616L probably benign Het
Tmem229a T C 6: 24,954,687 D356G probably damaging Het
Tmem30c A G 16: 57,266,562 S293P probably damaging Het
Tnfrsf14 C A 4: 154,926,598 probably null Het
Tnfrsf19 C T 14: 60,971,178 R298H possibly damaging Het
Ttc21a A G 9: 119,958,792 K809E probably benign Het
Ttn G A 2: 76,750,209 P23447S probably damaging Het
Uap1 T A 1: 170,151,138 probably null Het
Wdr82 A G 9: 106,185,304 Q252R probably benign Het
Zfp523 T C 17: 28,194,993 I34T probably benign Het
Zfp808 T A 13: 62,171,255 H99Q probably damaging Het
Other mutations in Kif20a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02448:Kif20a APN 18 34628454 missense possibly damaging 0.49
IGL02654:Kif20a APN 18 34632023 missense probably damaging 1.00
IGL02739:Kif20a APN 18 34628943 nonsense probably null
R0600:Kif20a UTSW 18 34629209 missense probably damaging 1.00
R0748:Kif20a UTSW 18 34628188 splice site probably benign
R0856:Kif20a UTSW 18 34631218 missense probably benign
R1278:Kif20a UTSW 18 34626777 missense probably benign 0.00
R1752:Kif20a UTSW 18 34631581 missense possibly damaging 0.82
R2036:Kif20a UTSW 18 34628462 missense possibly damaging 0.91
R2143:Kif20a UTSW 18 34625604 missense possibly damaging 0.55
R2144:Kif20a UTSW 18 34625604 missense possibly damaging 0.55
R4231:Kif20a UTSW 18 34632038 missense probably benign
R4372:Kif20a UTSW 18 34629478 missense probably damaging 1.00
R4426:Kif20a UTSW 18 34631941 missense probably damaging 1.00
R4584:Kif20a UTSW 18 34632611 missense probably damaging 1.00
R5524:Kif20a UTSW 18 34630625 critical splice donor site probably null
R5867:Kif20a UTSW 18 34632415 missense probably benign 0.01
R5949:Kif20a UTSW 18 34632415 missense probably benign 0.01
R5958:Kif20a UTSW 18 34632415 missense probably benign 0.01
R5959:Kif20a UTSW 18 34632415 missense probably benign 0.01
R5967:Kif20a UTSW 18 34630527 missense probably benign 0.10
R5969:Kif20a UTSW 18 34632415 missense probably benign 0.01
R6175:Kif20a UTSW 18 34628146 missense probably damaging 0.98
R6490:Kif20a UTSW 18 34629490 missense possibly damaging 0.84
R6694:Kif20a UTSW 18 34625526 missense probably damaging 0.98
R6866:Kif20a UTSW 18 34628493 missense probably benign 0.10
R7129:Kif20a UTSW 18 34632535 missense probably benign 0.00
R7217:Kif20a UTSW 18 34629560 missense probably benign 0.14
R7397:Kif20a UTSW 18 34627676 missense probably damaging 1.00
R7585:Kif20a UTSW 18 34625538 missense probably benign 0.03
R8302:Kif20a UTSW 18 34631977 missense probably damaging 1.00
R8306:Kif20a UTSW 18 34628391 missense probably benign 0.00
R8325:Kif20a UTSW 18 34626922 missense possibly damaging 0.68
X0027:Kif20a UTSW 18 34625530 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTCATTGCTAATGGTACCTGATCTC -3'
(R):5'- GGGCAACAACCATGCATCTTC -3'

Sequencing Primer
(F):5'- GCTAATGGTACCTGATCTCTTAAATG -3'
(R):5'- TTTTGCCAAAGGGAGATTTGAG -3'
Posted On2017-02-10