Incidental Mutation 'R5880:Ap1g2'
ID454385
Institutional Source Beutler Lab
Gene Symbol Ap1g2
Ensembl Gene ENSMUSG00000040701
Gene Nameadaptor protein complex AP-1, gamma 2 subunit
Synonymsgamma 2-adaptin, Adtg2
MMRRC Submission 043235-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.438) question?
Stock #R5880 (G1)
Quality Score113
Status Not validated
Chromosome14
Chromosomal Location55098575-55106593 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 55102700 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 392 (S392P)
Ref Sequence ENSEMBL: ENSMUSP00000128427 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022819] [ENSMUST00000036041] [ENSMUST00000050575] [ENSMUST00000124493] [ENSMUST00000127870] [ENSMUST00000131323] [ENSMUST00000151314] [ENSMUST00000170285] [ENSMUST00000185121]
Predicted Effect probably benign
Transcript: ENSMUST00000022819
SMART Domains Protein: ENSMUSP00000022819
Gene: ENSMUSG00000022208

DomainStartEndE-ValueType
MORN 13 34 1.63e0 SMART
MORN 59 80 1.62e-1 SMART
MORN 104 125 4.76e-2 SMART
MORN 127 148 5.26e-4 SMART
low complexity region 170 180 N/A INTRINSIC
low complexity region 216 246 N/A INTRINSIC
MORN 280 301 1.37e-2 SMART
MORN 303 324 3.29e-5 SMART
low complexity region 367 406 N/A INTRINSIC
low complexity region 453 467 N/A INTRINSIC
low complexity region 528 553 N/A INTRINSIC
low complexity region 613 627 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000036041
AA Change: S392P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000043996
Gene: ENSMUSG00000040701
AA Change: S392P

DomainStartEndE-ValueType
Pfam:Adaptin_N 24 575 2.7e-149 PFAM
low complexity region 624 631 N/A INTRINSIC
Alpha_adaptinC2 668 786 5.73e-39 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000050575
SMART Domains Protein: ENSMUSP00000056026
Gene: ENSMUSG00000045691

DomainStartEndE-ValueType
CYTH 5 200 1.29e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000124493
SMART Domains Protein: ENSMUSP00000121893
Gene: ENSMUSG00000022208

DomainStartEndE-ValueType
MORN 13 34 1.63e0 SMART
MORN 59 80 1.62e-1 SMART
MORN 104 125 4.76e-2 SMART
MORN 127 148 5.26e-4 SMART
low complexity region 170 180 N/A INTRINSIC
low complexity region 216 246 N/A INTRINSIC
MORN 280 301 1.37e-2 SMART
MORN 303 324 3.29e-5 SMART
low complexity region 367 406 N/A INTRINSIC
low complexity region 453 467 N/A INTRINSIC
low complexity region 528 553 N/A INTRINSIC
low complexity region 613 627 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127870
SMART Domains Protein: ENSMUSP00000116698
Gene: ENSMUSG00000040701

DomainStartEndE-ValueType
Pfam:Adaptin_N 24 197 5.7e-57 PFAM
low complexity region 222 235 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000131323
SMART Domains Protein: ENSMUSP00000115441
Gene: ENSMUSG00000040701

DomainStartEndE-ValueType
Pfam:Adaptin_N 24 197 5.7e-57 PFAM
low complexity region 222 235 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133004
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137481
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137548
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139536
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144197
Predicted Effect probably benign
Transcript: ENSMUST00000151314
SMART Domains Protein: ENSMUSP00000122796
Gene: ENSMUSG00000040701

DomainStartEndE-ValueType
Pfam:Adaptin_N 24 197 5.7e-57 PFAM
low complexity region 222 235 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153326
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153702
Predicted Effect probably damaging
Transcript: ENSMUST00000170285
AA Change: S392P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000128427
Gene: ENSMUSG00000040701
AA Change: S392P

DomainStartEndE-ValueType
Pfam:Adaptin_N 24 575 1.5e-149 PFAM
low complexity region 624 631 N/A INTRINSIC
Alpha_adaptinC2 668 786 5.73e-39 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183993
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185121
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.2%
  • 10x: 93.4%
  • 20x: 74.5%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes the gamma-2 subunit of the adaptor protein complex 1 (AP-1). AP-1 complex is a heterotetramer comprised of two heavy and one each of medium and small subunits. The encoded protein is a heavy subunit of AP-1 complex that regulates polarized sorting of cargo at the trans-Golgi network and endosomes. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jan 2015]
Allele List at MGI
Other mutations in this stock
Total: 24 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaa2 G A 18: 74,804,001 V319M probably damaging Het
Actrt2 T A 4: 154,667,290 T130S probably benign Het
Cdh23 T A 10: 60,384,934 N1344Y probably damaging Het
Cyp4x1 A T 4: 115,108,721 H469Q possibly damaging Het
Dhodh T A 8: 109,594,777 T326S probably benign Het
Ebf3 T G 7: 137,198,638 N529T probably benign Het
Echdc2 A C 4: 108,172,900 I133L possibly damaging Het
Fbn2 A T 18: 58,023,282 C2488* probably null Het
Fndc3b T A 3: 27,428,903 T1049S probably damaging Het
Igsf10 T C 3: 59,330,831 Y643C probably damaging Het
Il15ra A G 2: 11,730,615 *104W probably null Het
Iqgap3 T A 3: 88,117,202 S628R possibly damaging Het
Lrp1b C T 2: 41,341,814 V1215M probably benign Het
Mmp20 G A 9: 7,655,001 R370Q probably benign Het
Olfr120 T C 17: 37,726,654 V219A probably benign Het
Olfr731 A G 14: 50,238,715 S57P possibly damaging Het
Olfr984 A T 9: 40,101,247 M81K possibly damaging Het
Patj A T 4: 98,411,145 H168L probably damaging Het
Peak1 A T 9: 56,207,610 I319N probably damaging Het
Rgs20 A T 1: 4,923,881 C93S probably damaging Het
Sh3tc2 A T 18: 61,973,311 H137L probably benign Het
Spert C T 14: 75,583,803 V119I probably benign Het
Sycp2 A G 2: 178,374,470 V733A possibly damaging Het
Tet3 G C 6: 83,370,550 P1154R probably damaging Het
Other mutations in Ap1g2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01095:Ap1g2 APN 14 55105114 missense probably benign 0.01
IGL02421:Ap1g2 APN 14 55102402 missense probably damaging 1.00
IGL02633:Ap1g2 APN 14 55100647 splice site probably null
IGL02967:Ap1g2 APN 14 55105022 splice site probably benign
IGL03030:Ap1g2 APN 14 55106047 missense probably damaging 1.00
IGL03087:Ap1g2 APN 14 55103036 missense probably damaging 0.99
IGL03261:Ap1g2 APN 14 55100530 missense probably benign 0.00
IGL03308:Ap1g2 APN 14 55104876 missense probably benign 0.44
R0284:Ap1g2 UTSW 14 55101692 splice site probably benign
R0614:Ap1g2 UTSW 14 55099773 missense probably benign 0.00
R0762:Ap1g2 UTSW 14 55100411 splice site probably benign
R1561:Ap1g2 UTSW 14 55104887 missense probably damaging 1.00
R1889:Ap1g2 UTSW 14 55101429 missense probably damaging 1.00
R1938:Ap1g2 UTSW 14 55099772 missense possibly damaging 0.80
R1997:Ap1g2 UTSW 14 55102378 missense probably benign 0.00
R2169:Ap1g2 UTSW 14 55099340 critical splice acceptor site probably null
R3157:Ap1g2 UTSW 14 55099274 missense probably damaging 0.96
R3820:Ap1g2 UTSW 14 55100573 splice site probably benign
R3850:Ap1g2 UTSW 14 55104906 missense probably benign 0.03
R4750:Ap1g2 UTSW 14 55104365 missense probably damaging 1.00
R4909:Ap1g2 UTSW 14 55105026 critical splice donor site probably null
R5305:Ap1g2 UTSW 14 55099076 missense probably benign
R6243:Ap1g2 UTSW 14 55099073 missense probably benign
R6964:Ap1g2 UTSW 14 55099265 missense possibly damaging 0.85
R7039:Ap1g2 UTSW 14 55102654 nonsense probably null
R7180:Ap1g2 UTSW 14 55104451 missense probably damaging 1.00
R7563:Ap1g2 UTSW 14 55099749 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTATGTGCCATCGCTTGCTG -3'
(R):5'- GTGTCTACAGGAAACGGACG -3'

Sequencing Primer
(F):5'- CATCGCTTGCTGGGAGC -3'
(R):5'- TCCCTTAGCAGGTAGGCAGAG -3'
Posted On2017-02-10