Incidental Mutation 'R5880:Olfr120'
ID454387
Institutional Source Beutler Lab
Gene Symbol Olfr120
Ensembl Gene ENSMUSG00000063994
Gene Nameolfactory receptor 120
SynonymsGA_x6K02T2PSCP-2184981-2185946, MOR263-3
MMRRC Submission 043235-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.081) question?
Stock #R5880 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location37721808-37727220 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 37726654 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 219 (V219A)
Ref Sequence ENSEMBL: ENSMUSP00000094931 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077498] [ENSMUST00000207771]
Predicted Effect probably benign
Transcript: ENSMUST00000077498
AA Change: V219A

PolyPhen 2 Score 0.085 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000094931
Gene: ENSMUSG00000063994
AA Change: V219A

DomainStartEndE-ValueType
Pfam:7tm_4 46 323 5.6e-59 PFAM
Pfam:7TM_GPCR_Srsx 50 320 1e-5 PFAM
Pfam:7tm_1 56 305 6e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000207771
AA Change: V210A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.2%
  • 10x: 93.4%
  • 20x: 74.5%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 24 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaa2 G A 18: 74,804,001 V319M probably damaging Het
Actrt2 T A 4: 154,667,290 T130S probably benign Het
Ap1g2 A G 14: 55,102,700 S392P probably damaging Het
Cdh23 T A 10: 60,384,934 N1344Y probably damaging Het
Cyp4x1 A T 4: 115,108,721 H469Q possibly damaging Het
Dhodh T A 8: 109,594,777 T326S probably benign Het
Ebf3 T G 7: 137,198,638 N529T probably benign Het
Echdc2 A C 4: 108,172,900 I133L possibly damaging Het
Fbn2 A T 18: 58,023,282 C2488* probably null Het
Fndc3b T A 3: 27,428,903 T1049S probably damaging Het
Igsf10 T C 3: 59,330,831 Y643C probably damaging Het
Il15ra A G 2: 11,730,615 *104W probably null Het
Iqgap3 T A 3: 88,117,202 S628R possibly damaging Het
Lrp1b C T 2: 41,341,814 V1215M probably benign Het
Mmp20 G A 9: 7,655,001 R370Q probably benign Het
Olfr731 A G 14: 50,238,715 S57P possibly damaging Het
Olfr984 A T 9: 40,101,247 M81K possibly damaging Het
Patj A T 4: 98,411,145 H168L probably damaging Het
Peak1 A T 9: 56,207,610 I319N probably damaging Het
Rgs20 A T 1: 4,923,881 C93S probably damaging Het
Sh3tc2 A T 18: 61,973,311 H137L probably benign Het
Spert C T 14: 75,583,803 V119I probably benign Het
Sycp2 A G 2: 178,374,470 V733A possibly damaging Het
Tet3 G C 6: 83,370,550 P1154R probably damaging Het
Other mutations in Olfr120
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01402:Olfr120 APN 17 37726302 missense probably benign 0.08
IGL01925:Olfr120 APN 17 37726111 missense probably benign 0.18
IGL02901:Olfr120 APN 17 37726420 missense probably damaging 1.00
PIT4687001:Olfr120 UTSW 17 37726191 missense probably benign 0.01
R1645:Olfr120 UTSW 17 37726338 missense probably benign 0.01
R2218:Olfr120 UTSW 17 37726254 missense probably damaging 0.97
R2336:Olfr120 UTSW 17 37726798 missense probably benign 0.07
R4613:Olfr120 UTSW 17 37726696 missense probably damaging 1.00
R5237:Olfr120 UTSW 17 37726377 missense probably damaging 1.00
R6187:Olfr120 UTSW 17 37726141 missense probably damaging 0.99
Z1088:Olfr120 UTSW 17 37726092 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAATAGTTTCATGGGGAATGG -3'
(R):5'- GTCACCGCGGTGTAGAAAAG -3'

Sequencing Primer
(F):5'- CAATAGTTTCATGGGGAATGGGATGC -3'
(R):5'- AGGGCCAAGAGTTTATCTATTCCTG -3'
Posted On2017-02-10