Incidental Mutation 'R5881:Mccc1'
ID454404
Institutional Source Beutler Lab
Gene Symbol Mccc1
Ensembl Gene ENSMUSG00000027709
Gene Namemethylcrotonoyl-Coenzyme A carboxylase 1 (alpha)
Synonyms2310058B18Rik, MCCA, MCCalpha, 1810045E08Rik
MMRRC Submission 044085-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5881 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location35959312-36000678 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 35964382 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 601 (V601A)
Ref Sequence ENSEMBL: ENSMUSP00000029259 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029259] [ENSMUST00000199113]
Predicted Effect probably benign
Transcript: ENSMUST00000029259
AA Change: V601A

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000029259
Gene: ENSMUSG00000027709
AA Change: V601A

DomainStartEndE-ValueType
low complexity region 2 9 N/A INTRINSIC
Pfam:CPSase_L_chain 44 153 4.7e-50 PFAM
Pfam:ATP-grasp_4 156 337 3.7e-20 PFAM
Pfam:RimK 158 358 1e-6 PFAM
Pfam:CPSase_L_D2 159 367 2.8e-79 PFAM
Pfam:ATP-grasp_3 160 339 8.1e-9 PFAM
Pfam:Dala_Dala_lig_C 165 335 1.2e-16 PFAM
Pfam:ATP-grasp 166 337 3.7e-13 PFAM
Biotin_carb_C 379 486 7.14e-48 SMART
Pfam:Biotin_lipoyl 644 710 1.1e-17 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196662
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199092
Predicted Effect probably benign
Transcript: ENSMUST00000199113
SMART Domains Protein: ENSMUSP00000143266
Gene: ENSMUSG00000027709

DomainStartEndE-ValueType
low complexity region 2 9 N/A INTRINSIC
Pfam:CPSase_L_chain 44 153 3.5e-48 PFAM
Pfam:ATP-grasp_4 156 253 4.1e-10 PFAM
Pfam:CPSase_L_D2 159 253 1.2e-24 PFAM
Pfam:Dala_Dala_lig_C 165 254 1.6e-8 PFAM
Pfam:ATP-grasp 166 253 8.3e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200552
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.3%
  • 10x: 94.5%
  • 20x: 78.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the large subunit of 3-methylcrotonyl-CoA carboxylase. This enzyme functions as a heterodimer and catalyzes the carboxylation of 3-methylcrotonyl-CoA to form 3-methylglutaconyl-CoA. Mutations in this gene are associated with 3-Methylcrotonylglycinuria, an autosomal recessive disorder of leucine catabolism. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abi3 A C 11: 95,834,387 L159W probably damaging Het
Abi3 A T 11: 95,834,388 L159M probably damaging Het
Adam11 A C 11: 102,773,810 I406L probably benign Het
Ager G T 17: 34,600,077 V300L probably damaging Het
Ank3 C T 10: 69,986,830 S1726L probably benign Het
Boc A G 16: 44,490,651 I740T probably damaging Het
C8a T A 4: 104,853,932 D178V probably damaging Het
Ces3a G A 8: 105,050,566 V174M probably damaging Het
Cisd1 A T 10: 71,336,414 W13R probably damaging Het
Commd8 A T 5: 72,162,764 D111E probably benign Het
Ddx60 A T 8: 62,037,070 D1691V probably damaging Het
Desi2 A G 1: 178,237,913 Y15C probably damaging Het
Dnmt1 A G 9: 20,952,717 V24A probably damaging Het
Dock10 G A 1: 80,560,923 T968M probably benign Het
Dsel A T 1: 111,859,438 F1122L probably damaging Het
Eml3 T C 19: 8,933,443 F220L probably damaging Het
Entpd2 A C 2: 25,400,812 N443H probably damaging Het
Epgn A G 5: 91,028,363 N36S probably benign Het
Fsip2 G T 2: 82,984,441 S3506I possibly damaging Het
Gm10436 A G 12: 88,176,341 L169P probably damaging Het
Gprin3 T C 6: 59,354,786 S179G probably benign Het
Grifin G T 5: 140,563,587 H125N possibly damaging Het
Hils1 A G 11: 94,968,163 T95A possibly damaging Het
Hmcn1 A G 1: 150,630,327 V3816A probably damaging Het
Hspa14 A G 2: 3,498,170 F196L probably benign Het
Ice1 T C 13: 70,606,501 K489E probably benign Het
Jmjd6 C T 11: 116,839,856 W117* probably null Het
Lrit2 G T 14: 37,072,235 A419S probably benign Het
Mc3r T C 2: 172,249,172 S105P probably benign Het
Myo1f A G 17: 33,576,653 D91G probably damaging Het
Myo1f G A 17: 33,580,285 E255K possibly damaging Het
Necap1 T A 6: 122,881,544 D115E probably benign Het
Olfr1271 A T 2: 90,266,442 probably null Het
Olfr65 T A 7: 103,906,676 M79K probably damaging Het
Olfr725 G A 14: 50,034,987 R139C probably benign Het
Papd4 A T 13: 93,175,738 C180* probably null Het
Papln A G 12: 83,771,878 E78G probably null Het
Phldb3 T C 7: 24,626,722 probably null Het
Pkd1l2 A G 8: 116,997,582 I2394T probably damaging Het
Ppa2 A T 3: 133,330,439 N118I probably damaging Het
Ppef2 A T 5: 92,250,529 C43* probably null Het
Rab27a G A 9: 73,085,039 probably null Het
Rabgap1l A T 1: 160,342,113 F47I probably damaging Het
Rala A G 13: 17,893,161 I95T probably damaging Het
Rgl2 A G 17: 33,932,717 D245G probably benign Het
Rnf34 A T 5: 122,864,083 T35S probably damaging Het
Ros1 C T 10: 52,181,798 R51Q probably benign Het
Samd9l T C 6: 3,372,716 D1515G possibly damaging Het
Scn7a T C 2: 66,675,526 E1673G probably benign Het
Slc6a20a A C 9: 123,641,708 probably null Het
Tdrd5 A T 1: 156,294,500 S280T probably damaging Het
Tie1 T C 4: 118,475,603 I911V possibly damaging Het
Vipas39 G A 12: 87,251,807 R194* probably null Het
Ybx3 A C 6: 131,368,488 N307K possibly damaging Het
Ylpm1 A T 12: 85,042,125 H1216L probably damaging Het
Other mutations in Mccc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01483:Mccc1 APN 3 35989860 missense probably damaging 0.99
IGL01601:Mccc1 APN 3 35989952 missense probably benign 0.00
IGL01671:Mccc1 APN 3 35964460 missense probably benign
IGL01784:Mccc1 APN 3 35976748 missense probably damaging 0.99
IGL01878:Mccc1 APN 3 35975892 missense probably damaging 1.00
IGL02088:Mccc1 APN 3 35974202 missense probably damaging 1.00
IGL02709:Mccc1 APN 3 35990739 makesense probably null
IGL02932:Mccc1 APN 3 35960029 missense possibly damaging 0.86
IGL02972:Mccc1 APN 3 35985089 missense possibly damaging 0.58
IGL03145:Mccc1 APN 3 35968446 missense probably benign
P0019:Mccc1 UTSW 3 35964395 missense probably benign 0.00
R0244:Mccc1 UTSW 3 35990047 critical splice donor site probably null
R0391:Mccc1 UTSW 3 35963570 splice site probably benign
R1466:Mccc1 UTSW 3 35974286 missense probably benign 0.01
R1466:Mccc1 UTSW 3 35974286 missense probably benign 0.01
R1591:Mccc1 UTSW 3 35989857 missense probably damaging 1.00
R1663:Mccc1 UTSW 3 35978933 missense probably damaging 1.00
R1827:Mccc1 UTSW 3 35985001 missense probably damaging 1.00
R3800:Mccc1 UTSW 3 36000509 missense probably damaging 1.00
R4290:Mccc1 UTSW 3 35990068 missense probably damaging 0.98
R4291:Mccc1 UTSW 3 35990068 missense probably damaging 0.98
R4707:Mccc1 UTSW 3 35975873 missense probably damaging 0.99
R4757:Mccc1 UTSW 3 35995917 missense probably benign 0.32
R4783:Mccc1 UTSW 3 35975873 missense probably damaging 0.99
R4785:Mccc1 UTSW 3 35975873 missense probably damaging 0.99
R4798:Mccc1 UTSW 3 35985001 missense probably damaging 0.99
R4807:Mccc1 UTSW 3 35985046 missense probably damaging 1.00
R4915:Mccc1 UTSW 3 35997554 missense probably benign 0.00
R4917:Mccc1 UTSW 3 35997554 missense probably benign 0.00
R5010:Mccc1 UTSW 3 35979017 missense probably benign 0.15
R5106:Mccc1 UTSW 3 35972564 missense probably benign 0.22
R5168:Mccc1 UTSW 3 35990780 nonsense probably null
R5241:Mccc1 UTSW 3 35974196 missense probably benign 0.03
R5444:Mccc1 UTSW 3 35976742 missense probably benign 0.00
R5677:Mccc1 UTSW 3 35990048 critical splice donor site probably null
R5838:Mccc1 UTSW 3 35985082 missense possibly damaging 0.88
R6248:Mccc1 UTSW 3 35990164 missense probably damaging 1.00
R6381:Mccc1 UTSW 3 35976727 missense probably benign 0.13
R6564:Mccc1 UTSW 3 35976676 missense probably damaging 1.00
R6612:Mccc1 UTSW 3 35993930 missense probably benign 0.01
R6769:Mccc1 UTSW 3 35989843 critical splice donor site probably null
R6771:Mccc1 UTSW 3 35989843 critical splice donor site probably null
R7135:Mccc1 UTSW 3 35995818 missense probably damaging 1.00
R7236:Mccc1 UTSW 3 35983795 missense probably benign 0.13
R7274:Mccc1 UTSW 3 35989856 missense probably damaging 1.00
R7577:Mccc1 UTSW 3 35975794 critical splice donor site probably null
R7689:Mccc1 UTSW 3 35960983 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CAATGTCCAGTGAGAACTTTACAG -3'
(R):5'- TGCTTTGGAAACTGCCAATG -3'

Sequencing Primer
(F):5'- GGATCCAGGACTTTACCTTCCAGAG -3'
(R):5'- AACTGCCAATGATGACGGTGTTC -3'
Posted On2017-02-10