Incidental Mutation 'R5881:Epgn'
ID454411
Institutional Source Beutler Lab
Gene Symbol Epgn
Ensembl Gene ENSMUSG00000035020
Gene Nameepithelial mitogen
Synonyms2310069M11Rik, epigen
MMRRC Submission 044085-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5881 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location91027464-91035215 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 91028363 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 36 (N36S)
Ref Sequence ENSEMBL: ENSMUSP00000046987 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041516] [ENSMUST00000202724]
Predicted Effect probably benign
Transcript: ENSMUST00000041516
AA Change: N36S

PolyPhen 2 Score 0.056 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000046987
Gene: ENSMUSG00000035020
AA Change: N36S

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
EGF 58 95 1.01e-1 SMART
transmembrane domain 110 132 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000202724
AA Change: N21S

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000144500
Gene: ENSMUSG00000035020
AA Change: N21S

DomainStartEndE-ValueType
EGF 43 80 5.1e-4 SMART
transmembrane domain 95 117 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.3%
  • 10x: 94.5%
  • 20x: 78.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the epidermal growth factor family. Members of this family are ligands for the epidermal growth factor receptor and play a role in cell survival, proliferation and migration. This protein has been reported to have high mitogenic activity but low affinity for its receptor. Expression of this transcript and protein have been reported in cancer specimens of the breast, bladder, and prostate. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit moderate increase in absolute pancreas and spleen weight but normal epidermis and pilosebaceous unit development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abi3 A C 11: 95,834,387 L159W probably damaging Het
Abi3 A T 11: 95,834,388 L159M probably damaging Het
Adam11 A C 11: 102,773,810 I406L probably benign Het
Ager G T 17: 34,600,077 V300L probably damaging Het
Ank3 C T 10: 69,986,830 S1726L probably benign Het
Boc A G 16: 44,490,651 I740T probably damaging Het
C8a T A 4: 104,853,932 D178V probably damaging Het
Ces3a G A 8: 105,050,566 V174M probably damaging Het
Cisd1 A T 10: 71,336,414 W13R probably damaging Het
Commd8 A T 5: 72,162,764 D111E probably benign Het
Ddx60 A T 8: 62,037,070 D1691V probably damaging Het
Desi2 A G 1: 178,237,913 Y15C probably damaging Het
Dnmt1 A G 9: 20,952,717 V24A probably damaging Het
Dock10 G A 1: 80,560,923 T968M probably benign Het
Dsel A T 1: 111,859,438 F1122L probably damaging Het
Eml3 T C 19: 8,933,443 F220L probably damaging Het
Entpd2 A C 2: 25,400,812 N443H probably damaging Het
Fsip2 G T 2: 82,984,441 S3506I possibly damaging Het
Gm10436 A G 12: 88,176,341 L169P probably damaging Het
Gprin3 T C 6: 59,354,786 S179G probably benign Het
Grifin G T 5: 140,563,587 H125N possibly damaging Het
Hils1 A G 11: 94,968,163 T95A possibly damaging Het
Hmcn1 A G 1: 150,630,327 V3816A probably damaging Het
Hspa14 A G 2: 3,498,170 F196L probably benign Het
Ice1 T C 13: 70,606,501 K489E probably benign Het
Jmjd6 C T 11: 116,839,856 W117* probably null Het
Lrit2 G T 14: 37,072,235 A419S probably benign Het
Mc3r T C 2: 172,249,172 S105P probably benign Het
Mccc1 A G 3: 35,964,382 V601A probably benign Het
Myo1f A G 17: 33,576,653 D91G probably damaging Het
Myo1f G A 17: 33,580,285 E255K possibly damaging Het
Necap1 T A 6: 122,881,544 D115E probably benign Het
Olfr1271 A T 2: 90,266,442 probably null Het
Olfr65 T A 7: 103,906,676 M79K probably damaging Het
Olfr725 G A 14: 50,034,987 R139C probably benign Het
Papd4 A T 13: 93,175,738 C180* probably null Het
Papln A G 12: 83,771,878 E78G probably null Het
Phldb3 T C 7: 24,626,722 probably null Het
Pkd1l2 A G 8: 116,997,582 I2394T probably damaging Het
Ppa2 A T 3: 133,330,439 N118I probably damaging Het
Ppef2 A T 5: 92,250,529 C43* probably null Het
Rab27a G A 9: 73,085,039 probably null Het
Rabgap1l A T 1: 160,342,113 F47I probably damaging Het
Rala A G 13: 17,893,161 I95T probably damaging Het
Rgl2 A G 17: 33,932,717 D245G probably benign Het
Rnf34 A T 5: 122,864,083 T35S probably damaging Het
Ros1 C T 10: 52,181,798 R51Q probably benign Het
Samd9l T C 6: 3,372,716 D1515G possibly damaging Het
Scn7a T C 2: 66,675,526 E1673G probably benign Het
Slc6a20a A C 9: 123,641,708 probably null Het
Tdrd5 A T 1: 156,294,500 S280T probably damaging Het
Tie1 T C 4: 118,475,603 I911V possibly damaging Het
Vipas39 G A 12: 87,251,807 R194* probably null Het
Ybx3 A C 6: 131,368,488 N307K possibly damaging Het
Ylpm1 A T 12: 85,042,125 H1216L probably damaging Het
Other mutations in Epgn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02090:Epgn APN 5 91033957 missense probably damaging 0.99
R0309:Epgn UTSW 5 91032214 missense probably benign 0.06
R0478:Epgn UTSW 5 91031128 missense probably benign 0.00
R1034:Epgn UTSW 5 91032221 missense probably damaging 1.00
R4551:Epgn UTSW 5 91027562 nonsense probably null
R4552:Epgn UTSW 5 91027562 nonsense probably null
R4553:Epgn UTSW 5 91027562 nonsense probably null
R4997:Epgn UTSW 5 91032239 missense possibly damaging 0.58
R5177:Epgn UTSW 5 91028277 start gained probably benign
R5754:Epgn UTSW 5 91033948 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- TCTGGAACTGCCCTTGTCAG -3'
(R):5'- ACACCTACCTATCACTTCAGTTTAG -3'

Sequencing Primer
(F):5'- CAGGTTCTGGATCTCAGTGGAAAC -3'
(R):5'- GCATCATCATCTCTCTGAAATAGCTG -3'
Posted On2017-02-10