Incidental Mutation 'R5881:Olfr65'
ID454421
Institutional Source Beutler Lab
Gene Symbol Olfr65
Ensembl Gene ENSMUSG00000110259
Gene Nameolfactory receptor 65
Synonyms5'[b]3, GA_x6K02T2PBJ9-6634906-6633983, MOR1-2
MMRRC Submission 044085-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.108) question?
Stock #R5881 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location103903487-103908650 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 103906676 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 79 (M79K)
Ref Sequence ENSEMBL: ENSMUSP00000147914 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000106864] [ENSMUST00000209528] [ENSMUST00000214300]
Predicted Effect possibly damaging
Transcript: ENSMUST00000106864
AA Change: M76K

PolyPhen 2 Score 0.836 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000102477
Gene: ENSMUSG00000110259
AA Change: M76K

DomainStartEndE-ValueType
Pfam:7tm_4 32 310 2.1e-113 PFAM
Pfam:7TM_GPCR_Srsx 36 300 5.6e-7 PFAM
Pfam:7tm_1 42 293 5.9e-20 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000209528
AA Change: M79K

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
Predicted Effect possibly damaging
Transcript: ENSMUST00000214300
AA Change: M76K

PolyPhen 2 Score 0.836 (Sensitivity: 0.84; Specificity: 0.93)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.3%
  • 10x: 94.5%
  • 20x: 78.4%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abi3 A C 11: 95,834,387 L159W probably damaging Het
Abi3 A T 11: 95,834,388 L159M probably damaging Het
Adam11 A C 11: 102,773,810 I406L probably benign Het
Ager G T 17: 34,600,077 V300L probably damaging Het
Ank3 C T 10: 69,986,830 S1726L probably benign Het
Boc A G 16: 44,490,651 I740T probably damaging Het
C8a T A 4: 104,853,932 D178V probably damaging Het
Ces3a G A 8: 105,050,566 V174M probably damaging Het
Cisd1 A T 10: 71,336,414 W13R probably damaging Het
Commd8 A T 5: 72,162,764 D111E probably benign Het
Ddx60 A T 8: 62,037,070 D1691V probably damaging Het
Desi2 A G 1: 178,237,913 Y15C probably damaging Het
Dnmt1 A G 9: 20,952,717 V24A probably damaging Het
Dock10 G A 1: 80,560,923 T968M probably benign Het
Dsel A T 1: 111,859,438 F1122L probably damaging Het
Eml3 T C 19: 8,933,443 F220L probably damaging Het
Entpd2 A C 2: 25,400,812 N443H probably damaging Het
Epgn A G 5: 91,028,363 N36S probably benign Het
Fsip2 G T 2: 82,984,441 S3506I possibly damaging Het
Gm10436 A G 12: 88,176,341 L169P probably damaging Het
Gprin3 T C 6: 59,354,786 S179G probably benign Het
Grifin G T 5: 140,563,587 H125N possibly damaging Het
Hils1 A G 11: 94,968,163 T95A possibly damaging Het
Hmcn1 A G 1: 150,630,327 V3816A probably damaging Het
Hspa14 A G 2: 3,498,170 F196L probably benign Het
Ice1 T C 13: 70,606,501 K489E probably benign Het
Jmjd6 C T 11: 116,839,856 W117* probably null Het
Lrit2 G T 14: 37,072,235 A419S probably benign Het
Mc3r T C 2: 172,249,172 S105P probably benign Het
Mccc1 A G 3: 35,964,382 V601A probably benign Het
Myo1f A G 17: 33,576,653 D91G probably damaging Het
Myo1f G A 17: 33,580,285 E255K possibly damaging Het
Necap1 T A 6: 122,881,544 D115E probably benign Het
Olfr1271 A T 2: 90,266,442 probably null Het
Olfr725 G A 14: 50,034,987 R139C probably benign Het
Papd4 A T 13: 93,175,738 C180* probably null Het
Papln A G 12: 83,771,878 E78G probably null Het
Phldb3 T C 7: 24,626,722 probably null Het
Pkd1l2 A G 8: 116,997,582 I2394T probably damaging Het
Ppa2 A T 3: 133,330,439 N118I probably damaging Het
Ppef2 A T 5: 92,250,529 C43* probably null Het
Rab27a G A 9: 73,085,039 probably null Het
Rabgap1l A T 1: 160,342,113 F47I probably damaging Het
Rala A G 13: 17,893,161 I95T probably damaging Het
Rgl2 A G 17: 33,932,717 D245G probably benign Het
Rnf34 A T 5: 122,864,083 T35S probably damaging Het
Ros1 C T 10: 52,181,798 R51Q probably benign Het
Samd9l T C 6: 3,372,716 D1515G possibly damaging Het
Scn7a T C 2: 66,675,526 E1673G probably benign Het
Slc6a20a A C 9: 123,641,708 probably null Het
Tdrd5 A T 1: 156,294,500 S280T probably damaging Het
Tie1 T C 4: 118,475,603 I911V possibly damaging Het
Vipas39 G A 12: 87,251,807 R194* probably null Het
Ybx3 A C 6: 131,368,488 N307K possibly damaging Het
Ylpm1 A T 12: 85,042,125 H1216L probably damaging Het
Other mutations in Olfr65
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01079:Olfr65 APN 7 103906462 missense probably benign
IGL02830:Olfr65 APN 7 103906444 missense probably benign 0.32
IGL03238:Olfr65 APN 7 103906510 missense probably benign
R0674:Olfr65 UTSW 7 103907255 missense probably benign 0.01
R1711:Olfr65 UTSW 7 103906699 missense probably damaging 1.00
R2018:Olfr65 UTSW 7 103907042 missense possibly damaging 0.88
R2363:Olfr65 UTSW 7 103907060 missense probably benign 0.19
R2968:Olfr65 UTSW 7 103907312 missense probably benign 0.01
R2970:Olfr65 UTSW 7 103907312 missense probably benign 0.01
R3746:Olfr65 UTSW 7 103907060 missense probably benign 0.19
R4928:Olfr65 UTSW 7 103906672 missense probably damaging 1.00
R5092:Olfr65 UTSW 7 103907199 nonsense probably null
R5635:Olfr65 UTSW 7 103906638 missense probably benign 0.05
R5963:Olfr65 UTSW 7 103906961 missense probably benign 0.02
R5969:Olfr65 UTSW 7 103906910 missense probably damaging 0.98
R6859:Olfr65 UTSW 7 103906701 nonsense probably null
X0065:Olfr65 UTSW 7 103907216 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTGGAGAAAGCCCATCACC -3'
(R):5'- GATTGACAGACCAGCCCTCATC -3'

Sequencing Primer
(F):5'- TGGAGAAAGCCCATCACCTGATC -3'
(R):5'- ACCTTAGTATCTGTAAGGATGGTG -3'
Posted On2017-02-10