Mutagenetix > Incidental Mutation

Incidental Mutation 'R5881:Ddx60'

454422

Institutional Source

Beutler Lab

Gene Symbol

Ddx60

Ensembl Gene

ENSMUSG00000037921

Gene Name

DEAD (Asp-Glu-Ala-Asp) box polypeptide 60

Synonyms

MMRRC Submission

044085-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.170) question?

Stock #

R5881 (G1)

Quality Score

185

Status

Not validated

Chromosome

Chromosomal Location

61928087-62038244 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 62037070 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Valine at position 1691 (D1691V)

Ref Sequence

ENSEMBL: ENSMUSP00000091197 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000070631] [ENSMUST00000093485]

AlphaFold

E9PZQ1

Predicted Effect

probably damaging
Transcript: ENSMUST00000070631
AA Change: D1690V

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000070741
Gene: ENSMUSG00000037921
AA Change: D1690V

Domain	Start	End	E-Value	Type
low complexity region	99	110	N/A	INTRINSIC
low complexity region	364	376	N/A	INTRINSIC
DEXDc	758	949	1.05e-15	SMART
Blast:DEXDc	1007	1132	4e-24	BLAST
HELICc	1245	1328	4.35e-13	SMART
low complexity region	1362	1373	N/A	INTRINSIC
Blast:DEXDc	1503	1584	1e-20	BLAST

Predicted Effect

probably damaging
Transcript: ENSMUST00000093485
AA Change: D1691V

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000091197
Gene: ENSMUSG00000037921
AA Change: D1691V

Domain	Start	End	E-Value	Type
low complexity region	99	110	N/A	INTRINSIC
low complexity region	364	376	N/A	INTRINSIC
DEXDc	759	950	1.05e-15	SMART
Blast:DEXDc	1008	1133	4e-24	BLAST
HELICc	1246	1329	4.35e-13	SMART
low complexity region	1363	1374	N/A	INTRINSIC
Blast:DEXDc	1504	1585	1e-20	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000136121

Coding Region Coverage

1x: 99.9%
3x: 99.3%
10x: 94.5%
20x: 78.4%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal immunity to several viruses (IAV, EMCV, SINV) but increased susceptibility to VSV infection. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abi3	A	C	11: 95,834,387	L159W	probably damaging	Het
Abi3	A	T	11: 95,834,388	L159M	probably damaging	Het
Adam11	A	C	11: 102,773,810	I406L	probably benign	Het
Ager	G	T	17: 34,600,077	V300L	probably damaging	Het
Ank3	C	T	10: 69,986,830	S1726L	probably benign	Het
Boc	A	G	16: 44,490,651	I740T	probably damaging	Het
C8a	T	A	4: 104,853,932	D178V	probably damaging	Het
Ces3a	G	A	8: 105,050,566	V174M	probably damaging	Het
Cisd1	A	T	10: 71,336,414	W13R	probably damaging	Het
Commd8	A	T	5: 72,162,764	D111E	probably benign	Het
Desi2	A	G	1: 178,237,913	Y15C	probably damaging	Het
Dnmt1	A	G	9: 20,952,717	V24A	probably damaging	Het
Dock10	G	A	1: 80,560,923	T968M	probably benign	Het
Dsel	A	T	1: 111,859,438	F1122L	probably damaging	Het
Eml3	T	C	19: 8,933,443	F220L	probably damaging	Het
Entpd2	A	C	2: 25,400,812	N443H	probably damaging	Het
Epgn	A	G	5: 91,028,363	N36S	probably benign	Het
Fsip2	G	T	2: 82,984,441	S3506I	possibly damaging	Het
Gm10436	A	G	12: 88,176,341	L169P	probably damaging	Het
Gprin3	T	C	6: 59,354,786	S179G	probably benign	Het
Grifin	G	T	5: 140,563,587	H125N	possibly damaging	Het
Hils1	A	G	11: 94,968,163	T95A	possibly damaging	Het
Hmcn1	A	G	1: 150,630,327	V3816A	probably damaging	Het
Hspa14	A	G	2: 3,498,170	F196L	probably benign	Het
Ice1	T	C	13: 70,606,501	K489E	probably benign	Het
Jmjd6	C	T	11: 116,839,856	W117*	probably null	Het
Lrit2	G	T	14: 37,072,235	A419S	probably benign	Het
Mc3r	T	C	2: 172,249,172	S105P	probably benign	Het
Mccc1	A	G	3: 35,964,382	V601A	probably benign	Het
Myo1f	G	A	17: 33,580,285	E255K	possibly damaging	Het
Myo1f	A	G	17: 33,576,653	D91G	probably damaging	Het
Necap1	T	A	6: 122,881,544	D115E	probably benign	Het
Olfr1271	A	T	2: 90,266,442		probably null	Het
Olfr65	T	A	7: 103,906,676	M79K	probably damaging	Het
Olfr725	G	A	14: 50,034,987	R139C	probably benign	Het
Papd4	A	T	13: 93,175,738	C180*	probably null	Het
Papln	A	G	12: 83,771,878	E78G	probably null	Het
Phldb3	T	C	7: 24,626,722		probably null	Het
Pkd1l2	A	G	8: 116,997,582	I2394T	probably damaging	Het
Ppa2	A	T	3: 133,330,439	N118I	probably damaging	Het
Ppef2	A	T	5: 92,250,529	C43*	probably null	Het
Rab27a	G	A	9: 73,085,039		probably null	Het
Rabgap1l	A	T	1: 160,342,113	F47I	probably damaging	Het
Rala	A	G	13: 17,893,161	I95T	probably damaging	Het
Rgl2	A	G	17: 33,932,717	D245G	probably benign	Het
Rnf34	A	T	5: 122,864,083	T35S	probably damaging	Het
Ros1	C	T	10: 52,181,798	R51Q	probably benign	Het
Samd9l	T	C	6: 3,372,716	D1515G	possibly damaging	Het
Scn7a	T	C	2: 66,675,526	E1673G	probably benign	Het
Slc6a20a	A	C	9: 123,641,708		probably null	Het
Tdrd5	A	T	1: 156,294,500	S280T	probably damaging	Het
Tie1	T	C	4: 118,475,603	I911V	possibly damaging	Het
Vipas39	G	A	12: 87,251,807	R194*	probably null	Het
Ybx3	A	C	6: 131,368,488	N307K	possibly damaging	Het
Ylpm1	A	T	12: 85,042,125	H1216L	probably damaging	Het

Other mutations in Ddx60

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00340:Ddx60	APN	8	61958646	missense	probably damaging	1.00
IGL00915:Ddx60	APN	8	61987431	missense	possibly damaging	0.79
IGL00931:Ddx60	APN	8	61969583	missense	probably benign	0.18
IGL01023:Ddx60	APN	8	61942514	missense	probably damaging	0.99
IGL01313:Ddx60	APN	8	61982526	missense	probably damaging	1.00
IGL01615:Ddx60	APN	8	61963740	missense	probably null	0.81
IGL01733:Ddx60	APN	8	61983865	missense	probably damaging	0.99
IGL01779:Ddx60	APN	8	62017823	missense	possibly damaging	0.94
IGL01900:Ddx60	APN	8	62000709	splice site	probably benign
IGL02110:Ddx60	APN	8	62017247	critical splice donor site	probably null
IGL02302:Ddx60	APN	8	61975832	missense	possibly damaging	0.85
IGL02468:Ddx60	APN	8	61958642	missense	probably damaging	1.00
IGL02569:Ddx60	APN	8	62024951	missense	possibly damaging	0.93
IGL02622:Ddx60	APN	8	61942436	splice site	probably null
IGL02657:Ddx60	APN	8	61984115	missense	probably benign	0.01
IGL02677:Ddx60	APN	8	61988132	missense	probably damaging	1.00
IGL02701:Ddx60	APN	8	61979341	missense	probably damaging	0.96
IGL02806:Ddx60	APN	8	61956122	missense	probably benign	0.00
IGL03137:Ddx60	APN	8	61988083	missense	possibly damaging	0.61
IGL03295:Ddx60	APN	8	61956121	missense	possibly damaging	0.82
IGL03387:Ddx60	APN	8	62012449	missense	probably damaging	1.00
IGL03411:Ddx60	APN	8	61977882	critical splice acceptor site	probably null
Scatter	UTSW	8	62021314	missense	possibly damaging	0.80
shotgun	UTSW	8	62037067	missense	probably benign	0.28
splay	UTSW	8	62021309	missense	possibly damaging	0.80
G1Funyon:Ddx60	UTSW	8	62000597	missense	probably benign	0.01
PIT4504001:Ddx60	UTSW	8	61958113	missense	probably benign
PIT4677001:Ddx60	UTSW	8	61972254	missense	possibly damaging	0.87
R0090:Ddx60	UTSW	8	61942293	missense	probably damaging	1.00
R0266:Ddx60	UTSW	8	62033493	missense	possibly damaging	0.92
R0325:Ddx60	UTSW	8	61983855	missense	probably benign	0.00
R0367:Ddx60	UTSW	8	62017749	missense	possibly damaging	0.78
R0403:Ddx60	UTSW	8	61994541	splice site	probably benign
R0479:Ddx60	UTSW	8	61969657	missense	probably damaging	1.00
R0561:Ddx60	UTSW	8	62017794	missense	possibly damaging	0.93
R0844:Ddx60	UTSW	8	61987361	missense	probably benign	0.27
R1119:Ddx60	UTSW	8	61942544	missense	probably damaging	1.00
R1428:Ddx60	UTSW	8	61958159	splice site	probably benign
R1778:Ddx60	UTSW	8	61974176	missense	possibly damaging	0.85
R1840:Ddx60	UTSW	8	61969553	missense	probably damaging	0.99
R1964:Ddx60	UTSW	8	61948869	missense	probably benign	0.10
R1970:Ddx60	UTSW	8	61972206	missense	possibly damaging	0.93
R2101:Ddx60	UTSW	8	61940645	missense	probably damaging	1.00
R2174:Ddx60	UTSW	8	61956141	missense	probably damaging	1.00
R2174:Ddx60	UTSW	8	62017200	missense	probably benign	0.01
R2198:Ddx60	UTSW	8	61958063	missense	possibly damaging	0.79
R2332:Ddx60	UTSW	8	62037091	missense	probably benign	0.08
R2338:Ddx60	UTSW	8	62012436	missense	possibly damaging	0.91
R2379:Ddx60	UTSW	8	62037088	missense	probably damaging	1.00
R4010:Ddx60	UTSW	8	61954535	missense	possibly damaging	0.65
R4010:Ddx60	UTSW	8	61956144	missense	probably benign	0.25
R4133:Ddx60	UTSW	8	61972220	missense	probably damaging	0.99
R4282:Ddx60	UTSW	8	61994393	missense	probably damaging	0.99
R4382:Ddx60	UTSW	8	61948978	splice site	probably null
R4561:Ddx60	UTSW	8	61942461	missense	probably damaging	0.96
R4572:Ddx60	UTSW	8	61987421	missense	probably damaging	1.00
R4581:Ddx60	UTSW	8	62023261	missense	possibly damaging	0.90
R4635:Ddx60	UTSW	8	62037067	missense	probably benign	0.28
R4698:Ddx60	UTSW	8	62012424	missense	probably benign	0.01
R4807:Ddx60	UTSW	8	61979338	missense	probably damaging	1.00
R4858:Ddx60	UTSW	8	62021314	missense	possibly damaging	0.80
R4964:Ddx60	UTSW	8	61979338	missense	probably damaging	1.00
R5120:Ddx60	UTSW	8	61945906	missense	probably benign	0.01
R5187:Ddx60	UTSW	8	61974188	missense	probably damaging	1.00
R5222:Ddx60	UTSW	8	61984158	missense	probably damaging	0.99
R5400:Ddx60	UTSW	8	62010002	missense	possibly damaging	0.65
R5500:Ddx60	UTSW	8	61950451	missense	probably benign	0.28
R5514:Ddx60	UTSW	8	61958057	missense	probably damaging	1.00
R5668:Ddx60	UTSW	8	62000578	missense	probably benign	0.38
R5742:Ddx60	UTSW	8	61948921	missense	probably benign
R5772:Ddx60	UTSW	8	61948897	missense	probably damaging	1.00
R5810:Ddx60	UTSW	8	62012388	nonsense	probably null
R5815:Ddx60	UTSW	8	61963722	missense	probably damaging	0.98
R5820:Ddx60	UTSW	8	61956121	missense	possibly damaging	0.82
R5866:Ddx60	UTSW	8	61940740	missense	probably damaging	1.00
R5977:Ddx60	UTSW	8	62021410	critical splice donor site	probably null
R6048:Ddx60	UTSW	8	62000582	missense	probably benign	0.01
R6061:Ddx60	UTSW	8	62023241	missense	probably null	0.01
R6153:Ddx60	UTSW	8	61945940	missense	possibly damaging	0.47
R6287:Ddx60	UTSW	8	61950578	missense	probably damaging	1.00
R6415:Ddx60	UTSW	8	61983905	missense	probably benign	0.00
R6416:Ddx60	UTSW	8	61977950	missense	probably benign	0.00
R6416:Ddx60	UTSW	8	61998681	missense	probably benign
R6660:Ddx60	UTSW	8	61956239	missense	probably benign	0.00
R6694:Ddx60	UTSW	8	62037070	missense	probably damaging	1.00
R6715:Ddx60	UTSW	8	61983890	missense	probably benign	0.03
R6720:Ddx60	UTSW	8	62000689	missense	probably benign	0.10
R6937:Ddx60	UTSW	8	62037069	missense	probably damaging	1.00
R7153:Ddx60	UTSW	8	61988108	missense	possibly damaging	0.71
R7274:Ddx60	UTSW	8	61940108	critical splice donor site	probably null
R7409:Ddx60	UTSW	8	61958578	missense	probably benign	0.24
R7464:Ddx60	UTSW	8	61940674	missense	possibly damaging	0.82
R7670:Ddx60	UTSW	8	61975792	missense	probably damaging	1.00
R7904:Ddx60	UTSW	8	61977890	missense	possibly damaging	0.81
R7992:Ddx60	UTSW	8	61954535	missense	probably benign	0.03
R8124:Ddx60	UTSW	8	61983911	missense	probably benign
R8125:Ddx60	UTSW	8	61983911	missense	probably benign
R8126:Ddx60	UTSW	8	61983911	missense	probably benign
R8155:Ddx60	UTSW	8	62017171	missense	possibly damaging	0.61
R8174:Ddx60	UTSW	8	62017250	splice site	probably null
R8192:Ddx60	UTSW	8	61977968	missense	probably damaging	1.00
R8271:Ddx60	UTSW	8	61940108	critical splice donor site	probably null
R8301:Ddx60	UTSW	8	62000597	missense	probably benign	0.01
R8304:Ddx60	UTSW	8	61998769	missense	possibly damaging	0.67
R8319:Ddx60	UTSW	8	61942635	critical splice donor site	probably null
R8374:Ddx60	UTSW	8	61974171	missense	probably benign	0.01
R8401:Ddx60	UTSW	8	61956243	missense	possibly damaging	0.57
R8487:Ddx60	UTSW	8	61974150	missense	probably damaging	1.00
R8804:Ddx60	UTSW	8	61958606	missense	probably benign	0.27
R8826:Ddx60	UTSW	8	61945956	missense	probably benign	0.02
R8829:Ddx60	UTSW	8	61940661	missense	probably damaging	1.00
R8881:Ddx60	UTSW	8	62021309	missense	possibly damaging	0.80
R8884:Ddx60	UTSW	8	61994519	missense	possibly damaging	0.86
R8990:Ddx60	UTSW	8	61974134	nonsense	probably null
R9122:Ddx60	UTSW	8	61989864	missense	probably benign	0.16
R9225:Ddx60	UTSW	8	62017841	missense	probably benign	0.36
R9278:Ddx60	UTSW	8	61977978	missense	possibly damaging	0.83
R9293:Ddx60	UTSW	8	62009960	missense	possibly damaging	0.89
R9405:Ddx60	UTSW	8	61972214	missense	probably benign	0.03
X0003:Ddx60	UTSW	8	62033417	missense	possibly damaging	0.88
X0019:Ddx60	UTSW	8	61963692	missense	probably benign	0.01
Z1177:Ddx60	UTSW	8	62000588	missense	possibly damaging	0.92

Predicted Primers

PCR Primer
(F):5'- CCCTTTGCTGAATGTGACAC -3'
(R):5'- ACAAGAAGTTTGATGGCAACTC -3'

Sequencing Primer
(F):5'- CTTTAGAGGACAGCCCTT -3'
(R):5'- AGAAGTTTGATGGCAACTCTATTTG -3'

Posted On

2017-02-10