Incidental Mutation 'R5881:Pkd1l2'
ID 454424
Institutional Source Beutler Lab
Gene Symbol Pkd1l2
Ensembl Gene ENSMUSG00000034416
Gene Name polycystic kidney disease 1 like 2
Synonyms
MMRRC Submission 044085-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R5881 (G1)
Quality Score 190
Status Not validated
Chromosome 8
Chromosomal Location 116995679-117082449 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 116997582 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 2394 (I2394T)
Ref Sequence ENSEMBL: ENSMUSP00000104721 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040484] [ENSMUST00000098375] [ENSMUST00000109093]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000040484
SMART Domains Protein: ENSMUSP00000037131
Gene: ENSMUSG00000034424

DomainStartEndE-ValueType
Pfam:GCV_H 48 168 1.2e-51 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000098375
AA Change: I2393T

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000095977
Gene: ENSMUSG00000034416
AA Change: I2393T

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
CLECT 26 152 1.56e-21 SMART
Pfam:Gal_Lectin 168 250 1.8e-18 PFAM
PKD 260 341 3.84e-1 SMART
low complexity region 496 507 N/A INTRINSIC
Pfam:REJ 510 886 1.8e-13 PFAM
low complexity region 1050 1060 N/A INTRINSIC
GPS 1278 1327 1.61e-11 SMART
transmembrane domain 1346 1365 N/A INTRINSIC
LH2 1390 1509 6.05e-13 SMART
transmembrane domain 1552 1574 N/A INTRINSIC
transmembrane domain 1589 1611 N/A INTRINSIC
transmembrane domain 1815 1837 N/A INTRINSIC
transmembrane domain 1852 1874 N/A INTRINSIC
transmembrane domain 1940 1962 N/A INTRINSIC
Pfam:PKD_channel 1980 2403 6.4e-107 PFAM
Pfam:Ion_trans 2187 2396 2.5e-12 PFAM
low complexity region 2441 2458 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000109093
AA Change: I2394T

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000104721
Gene: ENSMUSG00000034416
AA Change: I2394T

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
CLECT 26 152 1.56e-21 SMART
Pfam:Gal_Lectin 168 250 6.9e-19 PFAM
PKD 260 341 3.84e-1 SMART
low complexity region 496 507 N/A INTRINSIC
Pfam:REJ 519 883 7e-11 PFAM
low complexity region 1051 1061 N/A INTRINSIC
GPS 1279 1328 1.61e-11 SMART
transmembrane domain 1347 1366 N/A INTRINSIC
LH2 1391 1510 6.05e-13 SMART
transmembrane domain 1553 1575 N/A INTRINSIC
transmembrane domain 1590 1612 N/A INTRINSIC
transmembrane domain 1816 1838 N/A INTRINSIC
transmembrane domain 1853 1875 N/A INTRINSIC
transmembrane domain 1941 1963 N/A INTRINSIC
Pfam:PKD_channel 1981 2403 5.9e-106 PFAM
Pfam:Ion_trans 2138 2409 3.4e-12 PFAM
low complexity region 2442 2459 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.3%
  • 10x: 94.5%
  • 20x: 78.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the polycystin protein family. The encoded protein contains 11 transmembrane domains, a latrophilin/CL-1-like GPCR proteolytic site (GPS) domain, and a polycystin-1, lipoxygenase, alpha-toxin (PLAT) domain. This protein may function as a component of cation channel pores. This gene appears to be a polymorphic pseudogene in humans, where some individuals contain a non-functional allele. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2014]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abi3 A C 11: 95,834,387 L159W probably damaging Het
Abi3 A T 11: 95,834,388 L159M probably damaging Het
Adam11 A C 11: 102,773,810 I406L probably benign Het
Ager G T 17: 34,600,077 V300L probably damaging Het
Ank3 C T 10: 69,986,830 S1726L probably benign Het
Boc A G 16: 44,490,651 I740T probably damaging Het
C8a T A 4: 104,853,932 D178V probably damaging Het
Ces3a G A 8: 105,050,566 V174M probably damaging Het
Cisd1 A T 10: 71,336,414 W13R probably damaging Het
Commd8 A T 5: 72,162,764 D111E probably benign Het
Ddx60 A T 8: 62,037,070 D1691V probably damaging Het
Desi2 A G 1: 178,237,913 Y15C probably damaging Het
Dnmt1 A G 9: 20,952,717 V24A probably damaging Het
Dock10 G A 1: 80,560,923 T968M probably benign Het
Dsel A T 1: 111,859,438 F1122L probably damaging Het
Eml3 T C 19: 8,933,443 F220L probably damaging Het
Entpd2 A C 2: 25,400,812 N443H probably damaging Het
Epgn A G 5: 91,028,363 N36S probably benign Het
Fsip2 G T 2: 82,984,441 S3506I possibly damaging Het
Gm10436 A G 12: 88,176,341 L169P probably damaging Het
Gprin3 T C 6: 59,354,786 S179G probably benign Het
Grifin G T 5: 140,563,587 H125N possibly damaging Het
Hils1 A G 11: 94,968,163 T95A possibly damaging Het
Hmcn1 A G 1: 150,630,327 V3816A probably damaging Het
Hspa14 A G 2: 3,498,170 F196L probably benign Het
Ice1 T C 13: 70,606,501 K489E probably benign Het
Jmjd6 C T 11: 116,839,856 W117* probably null Het
Lrit2 G T 14: 37,072,235 A419S probably benign Het
Mc3r T C 2: 172,249,172 S105P probably benign Het
Mccc1 A G 3: 35,964,382 V601A probably benign Het
Myo1f A G 17: 33,576,653 D91G probably damaging Het
Myo1f G A 17: 33,580,285 E255K possibly damaging Het
Necap1 T A 6: 122,881,544 D115E probably benign Het
Olfr1271 A T 2: 90,266,442 probably null Het
Olfr65 T A 7: 103,906,676 M79K probably damaging Het
Olfr725 G A 14: 50,034,987 R139C probably benign Het
Papd4 A T 13: 93,175,738 C180* probably null Het
Papln A G 12: 83,771,878 E78G probably null Het
Phldb3 T C 7: 24,626,722 probably null Het
Ppa2 A T 3: 133,330,439 N118I probably damaging Het
Ppef2 A T 5: 92,250,529 C43* probably null Het
Rab27a G A 9: 73,085,039 probably null Het
Rabgap1l A T 1: 160,342,113 F47I probably damaging Het
Rala A G 13: 17,893,161 I95T probably damaging Het
Rgl2 A G 17: 33,932,717 D245G probably benign Het
Rnf34 A T 5: 122,864,083 T35S probably damaging Het
Ros1 C T 10: 52,181,798 R51Q probably benign Het
Samd9l T C 6: 3,372,716 D1515G possibly damaging Het
Scn7a T C 2: 66,675,526 E1673G probably benign Het
Slc6a20a A C 9: 123,641,708 probably null Het
Tdrd5 A T 1: 156,294,500 S280T probably damaging Het
Tie1 T C 4: 118,475,603 I911V possibly damaging Het
Vipas39 G A 12: 87,251,807 R194* probably null Het
Ybx3 A C 6: 131,368,488 N307K possibly damaging Het
Ylpm1 A T 12: 85,042,125 H1216L probably damaging Het
Other mutations in Pkd1l2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01338:Pkd1l2 APN 8 117059520 nonsense probably null
IGL01353:Pkd1l2 APN 8 117057443 missense probably benign 0.24
IGL01362:Pkd1l2 APN 8 117021856 missense probably damaging 1.00
IGL01486:Pkd1l2 APN 8 117059592 missense probably benign
IGL01672:Pkd1l2 APN 8 117080732 missense possibly damaging 0.94
IGL01696:Pkd1l2 APN 8 117056387 missense probably benign 0.12
IGL01819:Pkd1l2 APN 8 116998174 missense probably damaging 1.00
IGL01833:Pkd1l2 APN 8 117060525 missense probably benign 0.00
IGL01981:Pkd1l2 APN 8 117016916 missense probably benign 0.04
IGL02066:Pkd1l2 APN 8 117009564 splice site probably benign
IGL02381:Pkd1l2 APN 8 117035800 splice site probably benign
IGL02416:Pkd1l2 APN 8 117040835 missense possibly damaging 0.82
IGL02736:Pkd1l2 APN 8 117040666 missense probably benign 0.00
IGL02828:Pkd1l2 APN 8 117029559 missense probably benign
IGL02861:Pkd1l2 APN 8 117065745 missense probably benign 0.07
IGL02862:Pkd1l2 APN 8 117065745 missense probably benign 0.07
IGL02883:Pkd1l2 APN 8 117065745 missense probably benign 0.07
IGL02884:Pkd1l2 APN 8 117065745 missense probably benign 0.07
IGL02894:Pkd1l2 APN 8 117013891 missense probably damaging 0.97
IGL02900:Pkd1l2 APN 8 117024091 missense probably benign 0.03
IGL02901:Pkd1l2 APN 8 117065745 missense probably benign 0.07
IGL02929:Pkd1l2 APN 8 117065745 missense probably benign 0.07
IGL02941:Pkd1l2 APN 8 117065745 missense probably benign 0.07
IGL02957:Pkd1l2 APN 8 117065745 missense probably benign 0.07
IGL02969:Pkd1l2 APN 8 117065745 missense probably benign 0.07
IGL03028:Pkd1l2 APN 8 117065745 missense probably benign 0.07
IGL03059:Pkd1l2 APN 8 117065745 missense probably benign 0.07
IGL03065:Pkd1l2 APN 8 117065745 missense probably benign 0.07
IGL03066:Pkd1l2 APN 8 117065745 missense probably benign 0.07
IGL03083:Pkd1l2 APN 8 117065745 missense probably benign 0.07
IGL03084:Pkd1l2 APN 8 117065745 missense probably benign 0.07
IGL03124:Pkd1l2 APN 8 117065745 missense probably benign 0.07
IGL03162:Pkd1l2 APN 8 117065745 missense probably benign 0.07
IGL03165:Pkd1l2 APN 8 117065745 missense probably benign 0.07
IGL03335:Pkd1l2 APN 8 117065745 missense probably benign 0.07
IGL03357:Pkd1l2 APN 8 116995809 missense probably damaging 1.00
IGL02835:Pkd1l2 UTSW 8 117065745 missense probably benign 0.07
PIT4453001:Pkd1l2 UTSW 8 117022022 missense probably benign 0.00
R0127:Pkd1l2 UTSW 8 117050048 splice site probably benign
R0309:Pkd1l2 UTSW 8 116997576 missense probably damaging 0.99
R0365:Pkd1l2 UTSW 8 117021850 missense probably benign 0.02
R0526:Pkd1l2 UTSW 8 117082260 missense probably damaging 1.00
R0571:Pkd1l2 UTSW 8 117082218 missense probably benign 0.01
R0716:Pkd1l2 UTSW 8 117051100 missense probably damaging 1.00
R0787:Pkd1l2 UTSW 8 117076177 missense possibly damaging 0.90
R0893:Pkd1l2 UTSW 8 117044492 missense probably damaging 0.99
R1256:Pkd1l2 UTSW 8 117019543 critical splice acceptor site probably null
R1391:Pkd1l2 UTSW 8 117054934 missense possibly damaging 0.87
R1474:Pkd1l2 UTSW 8 117065497 splice site probably benign
R1491:Pkd1l2 UTSW 8 117028408 missense probably damaging 1.00
R1520:Pkd1l2 UTSW 8 117046159 missense probably benign 0.00
R1521:Pkd1l2 UTSW 8 117065500 splice site probably null
R1544:Pkd1l2 UTSW 8 117038235 frame shift probably null
R1558:Pkd1l2 UTSW 8 117082252 missense possibly damaging 0.94
R1673:Pkd1l2 UTSW 8 117040775 missense probably benign 0.00
R1691:Pkd1l2 UTSW 8 117056419 missense possibly damaging 0.60
R1754:Pkd1l2 UTSW 8 117030719 missense possibly damaging 0.81
R1857:Pkd1l2 UTSW 8 117040669 missense possibly damaging 0.70
R1939:Pkd1l2 UTSW 8 117046182 nonsense probably null
R1955:Pkd1l2 UTSW 8 117043361 missense probably benign
R1957:Pkd1l2 UTSW 8 117030682 missense probably damaging 1.00
R1959:Pkd1l2 UTSW 8 117043231 critical splice donor site probably null
R2024:Pkd1l2 UTSW 8 117019533 missense probably benign
R2046:Pkd1l2 UTSW 8 116999955 missense probably damaging 1.00
R2102:Pkd1l2 UTSW 8 117081469 missense probably damaging 0.98
R2116:Pkd1l2 UTSW 8 117030722 missense possibly damaging 0.93
R2148:Pkd1l2 UTSW 8 117056325 missense probably damaging 0.98
R2251:Pkd1l2 UTSW 8 117057438 missense probably damaging 1.00
R2252:Pkd1l2 UTSW 8 117057438 missense probably damaging 1.00
R2366:Pkd1l2 UTSW 8 117043317 missense probably benign 0.01
R2566:Pkd1l2 UTSW 8 117019494 missense probably damaging 1.00
R2872:Pkd1l2 UTSW 8 117038164 missense probably benign 0.10
R2872:Pkd1l2 UTSW 8 117038164 missense probably benign 0.10
R2985:Pkd1l2 UTSW 8 117065551 missense probably benign 0.00
R3055:Pkd1l2 UTSW 8 117068315 critical splice acceptor site probably null
R3436:Pkd1l2 UTSW 8 117040739 missense probably benign 0.01
R4732:Pkd1l2 UTSW 8 116995842 critical splice acceptor site probably null
R4733:Pkd1l2 UTSW 8 116995842 critical splice acceptor site probably null
R4763:Pkd1l2 UTSW 8 117019429 missense probably damaging 0.96
R4789:Pkd1l2 UTSW 8 117011575 missense probably damaging 0.99
R4921:Pkd1l2 UTSW 8 117054885 missense probably benign 0.03
R4921:Pkd1l2 UTSW 8 117072549 missense probably damaging 0.97
R4999:Pkd1l2 UTSW 8 117047374 splice site probably null
R5057:Pkd1l2 UTSW 8 117055008 missense probably benign 0.21
R5209:Pkd1l2 UTSW 8 117056442 missense probably benign 0.23
R5241:Pkd1l2 UTSW 8 117035118 missense probably damaging 1.00
R5480:Pkd1l2 UTSW 8 117030649 missense probably damaging 0.99
R5501:Pkd1l2 UTSW 8 117065830 missense probably damaging 0.98
R5533:Pkd1l2 UTSW 8 117068116 missense probably benign 0.03
R5582:Pkd1l2 UTSW 8 117040783 nonsense probably null
R5610:Pkd1l2 UTSW 8 117042320 missense probably benign 0.04
R5770:Pkd1l2 UTSW 8 117055018 missense probably damaging 1.00
R5854:Pkd1l2 UTSW 8 117065746 missense possibly damaging 0.48
R5867:Pkd1l2 UTSW 8 117055011 missense probably damaging 0.96
R5906:Pkd1l2 UTSW 8 117029648 missense probably damaging 1.00
R5909:Pkd1l2 UTSW 8 117024056 missense probably benign 0.00
R6030:Pkd1l2 UTSW 8 117043237 missense probably damaging 1.00
R6030:Pkd1l2 UTSW 8 117043237 missense probably damaging 1.00
R6084:Pkd1l2 UTSW 8 117013987 missense probably damaging 1.00
R6122:Pkd1l2 UTSW 8 117082368 missense probably benign 0.02
R6216:Pkd1l2 UTSW 8 117081470 missense probably damaging 1.00
R6406:Pkd1l2 UTSW 8 117035847 missense probably damaging 0.99
R6417:Pkd1l2 UTSW 8 117013899 missense probably damaging 1.00
R6420:Pkd1l2 UTSW 8 117013899 missense probably damaging 1.00
R6601:Pkd1l2 UTSW 8 117040666 missense probably benign 0.00
R6743:Pkd1l2 UTSW 8 117030631 missense probably damaging 1.00
R7053:Pkd1l2 UTSW 8 117013942 missense probably damaging 1.00
R7144:Pkd1l2 UTSW 8 117076131 nonsense probably null
R7148:Pkd1l2 UTSW 8 117080786 missense probably benign 0.00
R7169:Pkd1l2 UTSW 8 117040835 missense possibly damaging 0.82
R7217:Pkd1l2 UTSW 8 116995797 missense probably benign 0.24
R7310:Pkd1l2 UTSW 8 117024034 missense probably benign
R7382:Pkd1l2 UTSW 8 117054871 missense possibly damaging 0.95
R7397:Pkd1l2 UTSW 8 117035902 missense possibly damaging 0.94
R7408:Pkd1l2 UTSW 8 117028479 missense possibly damaging 0.77
R7437:Pkd1l2 UTSW 8 117030682 missense probably damaging 0.96
R7492:Pkd1l2 UTSW 8 117068110 missense probably damaging 1.00
R7496:Pkd1l2 UTSW 8 117060594 missense possibly damaging 0.89
R7519:Pkd1l2 UTSW 8 117065529 missense probably benign
R7590:Pkd1l2 UTSW 8 117080786 missense probably benign 0.00
R7623:Pkd1l2 UTSW 8 117029645 missense probably damaging 1.00
R7768:Pkd1l2 UTSW 8 117054860 critical splice donor site probably null
R7897:Pkd1l2 UTSW 8 116998088 missense possibly damaging 0.69
R7982:Pkd1l2 UTSW 8 117051187 missense possibly damaging 0.70
R8024:Pkd1l2 UTSW 8 117076182 missense possibly damaging 0.85
R8140:Pkd1l2 UTSW 8 117047497 missense probably benign
R8145:Pkd1l2 UTSW 8 117055003 missense probably benign
R8228:Pkd1l2 UTSW 8 117065775 missense probably damaging 0.97
R8252:Pkd1l2 UTSW 8 117040733 missense probably benign 0.29
R8500:Pkd1l2 UTSW 8 117047563 critical splice acceptor site probably null
R8732:Pkd1l2 UTSW 8 117065572 missense probably benign 0.28
R8809:Pkd1l2 UTSW 8 116999921 missense probably damaging 1.00
R8896:Pkd1l2 UTSW 8 117013876 missense possibly damaging 0.91
R8961:Pkd1l2 UTSW 8 116999978 missense possibly damaging 0.52
R8985:Pkd1l2 UTSW 8 117038110 missense probably benign 0.01
R9008:Pkd1l2 UTSW 8 117042298 missense probably benign 0.32
R9091:Pkd1l2 UTSW 8 117032694 missense probably damaging 1.00
R9138:Pkd1l2 UTSW 8 117055009 missense probably benign 0.43
R9160:Pkd1l2 UTSW 8 117040669 missense possibly damaging 0.70
R9249:Pkd1l2 UTSW 8 117019420 missense probably damaging 0.99
R9270:Pkd1l2 UTSW 8 117032694 missense probably damaging 1.00
Z1176:Pkd1l2 UTSW 8 117054914 missense probably damaging 1.00
Z1177:Pkd1l2 UTSW 8 117030691 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGTCCTCAGACTATGAAAATATGG -3'
(R):5'- ACTCCAGACAGAGGACACTG -3'

Sequencing Primer
(F):5'- GACCGAGGTTCGATTCCTAGTAC -3'
(R):5'- GGACACTGTCCCCACTCTG -3'
Posted On 2017-02-10