Incidental Mutation 'R5881:Abi3'
ID454432
Institutional Source Beutler Lab
Gene Symbol Abi3
Ensembl Gene ENSMUSG00000018381
Gene NameABI gene family, member 3
Synonyms
MMRRC Submission 044085-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5881 (G1)
Quality Score136
Status Not validated
Chromosome11
Chromosomal Location95830074-95842476 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 95834387 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Tryptophan at position 159 (L159W)
Ref Sequence ENSEMBL: ENSMUSP00000061893 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054173] [ENSMUST00000059026] [ENSMUST00000107712] [ENSMUST00000133070] [ENSMUST00000150134]
Predicted Effect probably benign
Transcript: ENSMUST00000054173
SMART Domains Protein: ENSMUSP00000057858
Gene: ENSMUSG00000050860

DomainStartEndE-ValueType
Pfam:Put_Phosphatase 27 264 6.9e-103 PFAM
Pfam:HAD 29 211 1.9e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000059026
AA Change: L159W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000061893
Gene: ENSMUSG00000018381
AA Change: L159W

DomainStartEndE-ValueType
low complexity region 4 11 N/A INTRINSIC
Pfam:Abi_HHR 96 168 4.3e-31 PFAM
low complexity region 206 225 N/A INTRINSIC
low complexity region 233 252 N/A INTRINSIC
low complexity region 259 303 N/A INTRINSIC
SH3 312 367 1.41e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107712
SMART Domains Protein: ENSMUSP00000103340
Gene: ENSMUSG00000038811

DomainStartEndE-ValueType
G_gamma 5 69 6.71e-18 SMART
GGL 8 69 9.66e-23 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131049
Predicted Effect probably benign
Transcript: ENSMUST00000133070
SMART Domains Protein: ENSMUSP00000122280
Gene: ENSMUSG00000075595

DomainStartEndE-ValueType
low complexity region 95 108 N/A INTRINSIC
low complexity region 148 167 N/A INTRINSIC
low complexity region 173 213 N/A INTRINSIC
low complexity region 220 231 N/A INTRINSIC
ZnF_C2H2 244 267 7.9e-4 SMART
ZnF_C2H2 271 291 6.15e1 SMART
ZnF_C2H2 298 321 1.76e-1 SMART
ZnF_C2H2 328 350 2.53e-2 SMART
ZnF_C2H2 356 378 6.78e-3 SMART
ZnF_C2H2 384 406 2.95e-3 SMART
ZnF_C2H2 412 434 1.95e-3 SMART
Predicted Effect unknown
Transcript: ENSMUST00000137645
AA Change: L39W
SMART Domains Protein: ENSMUSP00000119990
Gene: ENSMUSG00000018381
AA Change: L39W

DomainStartEndE-ValueType
Pfam:Abi_HHR 1 49 8.8e-14 PFAM
low complexity region 87 106 N/A INTRINSIC
low complexity region 114 133 N/A INTRINSIC
low complexity region 140 183 N/A INTRINSIC
SH3 192 244 2.89e-13 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143492
Predicted Effect probably benign
Transcript: ENSMUST00000150134
Predicted Effect probably benign
Transcript: ENSMUST00000176538
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.3%
  • 10x: 94.5%
  • 20x: 78.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of an adaptor protein family. Members of this family encode proteins containing a homeobox homology domain, proline rich region and Src-homology 3 (SH3) domain, and are components of the Abi/WAVE complex which regulates actin polymerization. The encoded protein inhibits ectopic metastasis of tumor cells as well as cell migration. This may be accomplished through interaction with p21-activated kinase. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2013]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam11 A C 11: 102,773,810 I406L probably benign Het
Ager G T 17: 34,600,077 V300L probably damaging Het
Ank3 C T 10: 69,986,830 S1726L probably benign Het
Boc A G 16: 44,490,651 I740T probably damaging Het
C8a T A 4: 104,853,932 D178V probably damaging Het
Ces3a G A 8: 105,050,566 V174M probably damaging Het
Cisd1 A T 10: 71,336,414 W13R probably damaging Het
Commd8 A T 5: 72,162,764 D111E probably benign Het
Ddx60 A T 8: 62,037,070 D1691V probably damaging Het
Desi2 A G 1: 178,237,913 Y15C probably damaging Het
Dnmt1 A G 9: 20,952,717 V24A probably damaging Het
Dock10 G A 1: 80,560,923 T968M probably benign Het
Dsel A T 1: 111,859,438 F1122L probably damaging Het
Eml3 T C 19: 8,933,443 F220L probably damaging Het
Entpd2 A C 2: 25,400,812 N443H probably damaging Het
Epgn A G 5: 91,028,363 N36S probably benign Het
Fsip2 G T 2: 82,984,441 S3506I possibly damaging Het
Gm10436 A G 12: 88,176,341 L169P probably damaging Het
Gprin3 T C 6: 59,354,786 S179G probably benign Het
Grifin G T 5: 140,563,587 H125N possibly damaging Het
Hils1 A G 11: 94,968,163 T95A possibly damaging Het
Hmcn1 A G 1: 150,630,327 V3816A probably damaging Het
Hspa14 A G 2: 3,498,170 F196L probably benign Het
Ice1 T C 13: 70,606,501 K489E probably benign Het
Jmjd6 C T 11: 116,839,856 W117* probably null Het
Lrit2 G T 14: 37,072,235 A419S probably benign Het
Mc3r T C 2: 172,249,172 S105P probably benign Het
Mccc1 A G 3: 35,964,382 V601A probably benign Het
Myo1f A G 17: 33,576,653 D91G probably damaging Het
Myo1f G A 17: 33,580,285 E255K possibly damaging Het
Necap1 T A 6: 122,881,544 D115E probably benign Het
Olfr1271 A T 2: 90,266,442 probably null Het
Olfr65 T A 7: 103,906,676 M79K probably damaging Het
Olfr725 G A 14: 50,034,987 R139C probably benign Het
Papd4 A T 13: 93,175,738 C180* probably null Het
Papln A G 12: 83,771,878 E78G probably null Het
Phldb3 T C 7: 24,626,722 probably null Het
Pkd1l2 A G 8: 116,997,582 I2394T probably damaging Het
Ppa2 A T 3: 133,330,439 N118I probably damaging Het
Ppef2 A T 5: 92,250,529 C43* probably null Het
Rab27a G A 9: 73,085,039 probably null Het
Rabgap1l A T 1: 160,342,113 F47I probably damaging Het
Rala A G 13: 17,893,161 I95T probably damaging Het
Rgl2 A G 17: 33,932,717 D245G probably benign Het
Rnf34 A T 5: 122,864,083 T35S probably damaging Het
Ros1 C T 10: 52,181,798 R51Q probably benign Het
Samd9l T C 6: 3,372,716 D1515G possibly damaging Het
Scn7a T C 2: 66,675,526 E1673G probably benign Het
Slc6a20a A C 9: 123,641,708 probably null Het
Tdrd5 A T 1: 156,294,500 S280T probably damaging Het
Tie1 T C 4: 118,475,603 I911V possibly damaging Het
Vipas39 G A 12: 87,251,807 R194* probably null Het
Ybx3 A C 6: 131,368,488 N307K possibly damaging Het
Ylpm1 A T 12: 85,042,125 H1216L probably damaging Het
Other mutations in Abi3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01759:Abi3 APN 11 95835799 missense probably damaging 1.00
R0045:Abi3 UTSW 11 95832715 makesense probably null
R0626:Abi3 UTSW 11 95837111 missense probably benign 0.28
R0690:Abi3 UTSW 11 95833634 unclassified probably benign
R4653:Abi3 UTSW 11 95832811 missense probably benign 0.34
R5358:Abi3 UTSW 11 95842108 missense probably benign 0.21
R5881:Abi3 UTSW 11 95834388 missense probably damaging 1.00
R6020:Abi3 UTSW 11 95842025 nonsense probably null
R6036:Abi3 UTSW 11 95832858 unclassified probably benign
R6036:Abi3 UTSW 11 95832858 unclassified probably benign
R6130:Abi3 UTSW 11 95837095 missense probably damaging 1.00
R6388:Abi3 UTSW 11 95833638 critical splice donor site probably null
R6963:Abi3 UTSW 11 95832741 unclassified probably benign
R7867:Abi3 UTSW 11 95834025 missense possibly damaging 0.85
R7950:Abi3 UTSW 11 95834025 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- AGACTCAAGTGCTCACCCTG -3'
(R):5'- GCAAAGGGCAACTCAGTCAC -3'

Sequencing Primer
(F):5'- ATCCGGGGTGGTCTCCTAG -3'
(R):5'- AGGGCAACTCAGTCACTGTGG -3'
Posted On2017-02-10