Incidental Mutation 'R5881:Ice1'
ID 454442
Institutional Source Beutler Lab
Gene Symbol Ice1
Ensembl Gene ENSMUSG00000034525
Gene Name interactor of little elongation complex ELL subunit 1
Synonyms BC018507
MMRRC Submission 044085-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.952) question?
Stock # R5881 (G1)
Quality Score 225
Status Not validated
Chromosome 13
Chromosomal Location 70551707-70637634 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 70606501 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Glutamic Acid at position 489 (K489E)
Ref Sequence ENSEMBL: ENSMUSP00000036482 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043493] [ENSMUST00000220637] [ENSMUST00000222568]
AlphaFold E9Q286
Predicted Effect probably benign
Transcript: ENSMUST00000043493
AA Change: K489E

PolyPhen 2 Score 0.038 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000036482
Gene: ENSMUSG00000034525
AA Change: K489E

DomainStartEndE-ValueType
coiled coil region 22 185 N/A INTRINSIC
low complexity region 276 292 N/A INTRINSIC
low complexity region 338 351 N/A INTRINSIC
low complexity region 372 378 N/A INTRINSIC
low complexity region 469 481 N/A INTRINSIC
low complexity region 606 619 N/A INTRINSIC
low complexity region 769 780 N/A INTRINSIC
low complexity region 946 958 N/A INTRINSIC
low complexity region 1061 1073 N/A INTRINSIC
low complexity region 1329 1352 N/A INTRINSIC
low complexity region 1595 1604 N/A INTRINSIC
low complexity region 1656 1671 N/A INTRINSIC
SCOP:d1gw5a_ 2026 2223 5e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000220637
Predicted Effect probably benign
Transcript: ENSMUST00000222568
Predicted Effect probably benign
Transcript: ENSMUST00000222627
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.3%
  • 10x: 94.5%
  • 20x: 78.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abi3 A C 11: 95,834,387 L159W probably damaging Het
Abi3 A T 11: 95,834,388 L159M probably damaging Het
Adam11 A C 11: 102,773,810 I406L probably benign Het
Ager G T 17: 34,600,077 V300L probably damaging Het
Ank3 C T 10: 69,986,830 S1726L probably benign Het
Boc A G 16: 44,490,651 I740T probably damaging Het
C8a T A 4: 104,853,932 D178V probably damaging Het
Ces3a G A 8: 105,050,566 V174M probably damaging Het
Cisd1 A T 10: 71,336,414 W13R probably damaging Het
Commd8 A T 5: 72,162,764 D111E probably benign Het
Ddx60 A T 8: 62,037,070 D1691V probably damaging Het
Desi2 A G 1: 178,237,913 Y15C probably damaging Het
Dnmt1 A G 9: 20,952,717 V24A probably damaging Het
Dock10 G A 1: 80,560,923 T968M probably benign Het
Dsel A T 1: 111,859,438 F1122L probably damaging Het
Eml3 T C 19: 8,933,443 F220L probably damaging Het
Entpd2 A C 2: 25,400,812 N443H probably damaging Het
Epgn A G 5: 91,028,363 N36S probably benign Het
Fsip2 G T 2: 82,984,441 S3506I possibly damaging Het
Gm10436 A G 12: 88,176,341 L169P probably damaging Het
Gprin3 T C 6: 59,354,786 S179G probably benign Het
Grifin G T 5: 140,563,587 H125N possibly damaging Het
Hils1 A G 11: 94,968,163 T95A possibly damaging Het
Hmcn1 A G 1: 150,630,327 V3816A probably damaging Het
Hspa14 A G 2: 3,498,170 F196L probably benign Het
Jmjd6 C T 11: 116,839,856 W117* probably null Het
Lrit2 G T 14: 37,072,235 A419S probably benign Het
Mc3r T C 2: 172,249,172 S105P probably benign Het
Mccc1 A G 3: 35,964,382 V601A probably benign Het
Myo1f A G 17: 33,576,653 D91G probably damaging Het
Myo1f G A 17: 33,580,285 E255K possibly damaging Het
Necap1 T A 6: 122,881,544 D115E probably benign Het
Olfr1271 A T 2: 90,266,442 probably null Het
Olfr65 T A 7: 103,906,676 M79K probably damaging Het
Olfr725 G A 14: 50,034,987 R139C probably benign Het
Papd4 A T 13: 93,175,738 C180* probably null Het
Papln A G 12: 83,771,878 E78G probably null Het
Phldb3 T C 7: 24,626,722 probably null Het
Pkd1l2 A G 8: 116,997,582 I2394T probably damaging Het
Ppa2 A T 3: 133,330,439 N118I probably damaging Het
Ppef2 A T 5: 92,250,529 C43* probably null Het
Rab27a G A 9: 73,085,039 probably null Het
Rabgap1l A T 1: 160,342,113 F47I probably damaging Het
Rala A G 13: 17,893,161 I95T probably damaging Het
Rgl2 A G 17: 33,932,717 D245G probably benign Het
Rnf34 A T 5: 122,864,083 T35S probably damaging Het
Ros1 C T 10: 52,181,798 R51Q probably benign Het
Samd9l T C 6: 3,372,716 D1515G possibly damaging Het
Scn7a T C 2: 66,675,526 E1673G probably benign Het
Slc6a20a A C 9: 123,641,708 probably null Het
Tdrd5 A T 1: 156,294,500 S280T probably damaging Het
Tie1 T C 4: 118,475,603 I911V possibly damaging Het
Vipas39 G A 12: 87,251,807 R194* probably null Het
Ybx3 A C 6: 131,368,488 N307K possibly damaging Het
Ylpm1 A T 12: 85,042,125 H1216L probably damaging Het
Other mutations in Ice1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00904:Ice1 APN 13 70602289 missense probably damaging 1.00
IGL01155:Ice1 APN 13 70604082 missense possibly damaging 0.93
IGL01298:Ice1 APN 13 70604904 missense possibly damaging 0.93
IGL01797:Ice1 APN 13 70623946 missense probably damaging 1.00
IGL02423:Ice1 APN 13 70592599 missense probably damaging 1.00
IGL02583:Ice1 APN 13 70605735 missense possibly damaging 0.80
IGL02794:Ice1 APN 13 70609159 missense possibly damaging 0.95
IGL02882:Ice1 APN 13 70624474 splice site probably benign
IGL02929:Ice1 APN 13 70596203 missense probably damaging 1.00
IGL03343:Ice1 APN 13 70602929 missense probably damaging 1.00
IGL03384:Ice1 APN 13 70603249 missense probably benign 0.00
PIT4651001:Ice1 UTSW 13 70623921 critical splice donor site probably null
R0078:Ice1 UTSW 13 70603348 missense probably damaging 0.98
R0081:Ice1 UTSW 13 70619044 nonsense probably null
R0281:Ice1 UTSW 13 70604047 missense possibly damaging 0.64
R0557:Ice1 UTSW 13 70601191 missense probably benign 0.08
R0973:Ice1 UTSW 13 70602427 missense probably benign 0.04
R0973:Ice1 UTSW 13 70602427 missense probably benign 0.04
R0974:Ice1 UTSW 13 70602427 missense probably benign 0.04
R1033:Ice1 UTSW 13 70606594 missense probably damaging 0.96
R1371:Ice1 UTSW 13 70596221 missense probably damaging 1.00
R1525:Ice1 UTSW 13 70605410 missense probably benign 0.01
R1539:Ice1 UTSW 13 70605904 missense probably damaging 1.00
R1596:Ice1 UTSW 13 70604895 missense possibly damaging 0.94
R1603:Ice1 UTSW 13 70603353 missense probably benign 0.01
R1680:Ice1 UTSW 13 70605448 missense probably benign 0.00
R1737:Ice1 UTSW 13 70606325 missense probably damaging 0.99
R1766:Ice1 UTSW 13 70604442 missense possibly damaging 0.78
R1774:Ice1 UTSW 13 70604553 missense probably damaging 1.00
R1834:Ice1 UTSW 13 70615338 missense probably damaging 0.99
R1840:Ice1 UTSW 13 70606218 missense probably benign 0.00
R1898:Ice1 UTSW 13 70602307 missense possibly damaging 0.83
R1930:Ice1 UTSW 13 70605083 missense probably benign 0.18
R2000:Ice1 UTSW 13 70602427 missense possibly damaging 0.58
R2106:Ice1 UTSW 13 70605622 missense probably benign 0.00
R2293:Ice1 UTSW 13 70614957 missense probably damaging 1.00
R2377:Ice1 UTSW 13 70602780 missense probably damaging 1.00
R2909:Ice1 UTSW 13 70596173 missense probably damaging 1.00
R2965:Ice1 UTSW 13 70602578 missense probably benign 0.31
R3730:Ice1 UTSW 13 70603240 missense probably damaging 1.00
R3886:Ice1 UTSW 13 70605370 missense probably benign 0.00
R3914:Ice1 UTSW 13 70606084 missense probably benign 0.30
R4051:Ice1 UTSW 13 70603527 missense probably damaging 1.00
R4321:Ice1 UTSW 13 70603110 missense possibly damaging 0.83
R4499:Ice1 UTSW 13 70609027 missense possibly damaging 0.87
R4729:Ice1 UTSW 13 70606384 missense probably damaging 1.00
R5078:Ice1 UTSW 13 70604850 missense probably benign
R5431:Ice1 UTSW 13 70592650 missense probably damaging 1.00
R5722:Ice1 UTSW 13 70615100 missense possibly damaging 0.95
R5914:Ice1 UTSW 13 70606377 missense possibly damaging 0.93
R6171:Ice1 UTSW 13 70606731 missense probably benign
R6253:Ice1 UTSW 13 70603164 missense probably damaging 1.00
R6274:Ice1 UTSW 13 70594839 missense probably damaging 0.97
R6518:Ice1 UTSW 13 70606309 missense possibly damaging 0.89
R6665:Ice1 UTSW 13 70603473 missense possibly damaging 0.85
R6714:Ice1 UTSW 13 70615263 splice site probably null
R6853:Ice1 UTSW 13 70603302 missense possibly damaging 0.92
R6917:Ice1 UTSW 13 70594894 missense probably damaging 1.00
R7032:Ice1 UTSW 13 70596164 missense probably damaging 0.99
R7176:Ice1 UTSW 13 70624406 critical splice donor site probably null
R7352:Ice1 UTSW 13 70606102 nonsense probably null
R7445:Ice1 UTSW 13 70596167 missense
R7646:Ice1 UTSW 13 70589797 missense possibly damaging 0.93
R7647:Ice1 UTSW 13 70589797 missense possibly damaging 0.93
R7648:Ice1 UTSW 13 70589797 missense possibly damaging 0.93
R7650:Ice1 UTSW 13 70589797 missense possibly damaging 0.93
R7650:Ice1 UTSW 13 70605483 missense probably damaging 1.00
R7812:Ice1 UTSW 13 70603005 missense possibly damaging 0.63
R8061:Ice1 UTSW 13 70603732 missense probably damaging 1.00
R8129:Ice1 UTSW 13 70606201 missense probably benign 0.02
R8283:Ice1 UTSW 13 70604430 missense probably damaging 0.97
R8303:Ice1 UTSW 13 70606407 missense probably benign 0.04
R8444:Ice1 UTSW 13 70604376 missense probably damaging 1.00
R8474:Ice1 UTSW 13 70604447 missense probably benign 0.42
R8751:Ice1 UTSW 13 70602891 missense probably damaging 1.00
R8887:Ice1 UTSW 13 70602931 missense probably damaging 1.00
R8911:Ice1 UTSW 13 70592668 missense
R8954:Ice1 UTSW 13 70610578 missense probably damaging 1.00
R9345:Ice1 UTSW 13 70592639 missense
R9438:Ice1 UTSW 13 70606315 missense probably benign 0.04
X0026:Ice1 UTSW 13 70592602 missense probably damaging 1.00
Z1176:Ice1 UTSW 13 70605201 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACACAAAGCTTTTGACGACAG -3'
(R):5'- AAAGCCTGGGTCACTGGAAG -3'

Sequencing Primer
(F):5'- ACGACAGGGTTTTTCCTTCAG -3'
(R):5'- GTAAACAGTCTGACACCTCTTGG -3'
Posted On 2017-02-10