Mutagenetix > Incidental Mutations

Incidental Mutation 'R5881:Myo1f'

454449

Institutional Source

Beutler Lab

Gene Symbol

Myo1f

Ensembl Gene

ENSMUSG00000024300

Gene Name

myosin IF

Synonyms

C330006B10Rik

MMRRC Submission

044085-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.169) question?

Stock #

R5881 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

33555719-33607764 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 33580285 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Lysine at position 255 (E255K)

Ref Sequence

ENSEMBL: ENSMUSP00000134715 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000087605] [ENSMUST00000173372] [ENSMUST00000174695]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000087605
AA Change: E255K

PolyPhen 2 Score 0.458 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000084887
Gene: ENSMUSG00000024300
AA Change: E255K

Domain	Start	End	E-Value	Type
MYSc	11	691	N/A	SMART
IQ	692	714	7.57e0	SMART
Pfam:Myosin_TH1	717	909	1.7e-51	PFAM
low complexity region	939	952	N/A	INTRINSIC
low complexity region	973	987	N/A	INTRINSIC
low complexity region	991	1001	N/A	INTRINSIC
SH3	1044	1098	2.09e-19	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000173372
AA Change: E255K

PolyPhen 2 Score 0.458 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000134715
Gene: ENSMUSG00000024300
AA Change: E255K

Domain	Start	End	E-Value	Type
MYSc	11	691	N/A	SMART
IQ	692	714	7.57e0	SMART
Pfam:Myosin_TH1	716	780	6e-23	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000173426

Predicted Effect

probably benign
Transcript: ENSMUST00000174695

SMART Domains

Protein: ENSMUSP00000134600
Gene: ENSMUSG00000024300

Domain	Start	End	E-Value	Type
Pfam:Myosin_head	47	98	1.3e-21	PFAM

Coding Region Coverage

1x: 99.9%
3x: 99.3%
10x: 94.5%
20x: 78.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Myosins are molecular motors that use the energy from ATP hydrolysis to generate force on actin filaments. The protein encoded by this gene is an unconventional myosin that may be involved in the intracellular movement of membrane-enclosed compartments. There is evidence to suggest that mutations in this gene can result in hearing loss. [provided by RefSeq, Jan 2017]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired neutrophil migration and adhesion. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abi3	A	C	11: 95,834,387	L159W	probably damaging	Het
Abi3	A	T	11: 95,834,388	L159M	probably damaging	Het
Adam11	A	C	11: 102,773,810	I406L	probably benign	Het
Ager	G	T	17: 34,600,077	V300L	probably damaging	Het
Ank3	C	T	10: 69,986,830	S1726L	probably benign	Het
Boc	A	G	16: 44,490,651	I740T	probably damaging	Het
C8a	T	A	4: 104,853,932	D178V	probably damaging	Het
Ces3a	G	A	8: 105,050,566	V174M	probably damaging	Het
Cisd1	A	T	10: 71,336,414	W13R	probably damaging	Het
Commd8	A	T	5: 72,162,764	D111E	probably benign	Het
Ddx60	A	T	8: 62,037,070	D1691V	probably damaging	Het
Desi2	A	G	1: 178,237,913	Y15C	probably damaging	Het
Dnmt1	A	G	9: 20,952,717	V24A	probably damaging	Het
Dock10	G	A	1: 80,560,923	T968M	probably benign	Het
Dsel	A	T	1: 111,859,438	F1122L	probably damaging	Het
Eml3	T	C	19: 8,933,443	F220L	probably damaging	Het
Entpd2	A	C	2: 25,400,812	N443H	probably damaging	Het
Epgn	A	G	5: 91,028,363	N36S	probably benign	Het
Fsip2	G	T	2: 82,984,441	S3506I	possibly damaging	Het
Gm10436	A	G	12: 88,176,341	L169P	probably damaging	Het
Gprin3	T	C	6: 59,354,786	S179G	probably benign	Het
Grifin	G	T	5: 140,563,587	H125N	possibly damaging	Het
Hils1	A	G	11: 94,968,163	T95A	possibly damaging	Het
Hmcn1	A	G	1: 150,630,327	V3816A	probably damaging	Het
Hspa14	A	G	2: 3,498,170	F196L	probably benign	Het
Ice1	T	C	13: 70,606,501	K489E	probably benign	Het
Jmjd6	C	T	11: 116,839,856	W117*	probably null	Het
Lrit2	G	T	14: 37,072,235	A419S	probably benign	Het
Mc3r	T	C	2: 172,249,172	S105P	probably benign	Het
Mccc1	A	G	3: 35,964,382	V601A	probably benign	Het
Necap1	T	A	6: 122,881,544	D115E	probably benign	Het
Olfr1271	A	T	2: 90,266,442		probably null	Het
Olfr65	T	A	7: 103,906,676	M79K	probably damaging	Het
Olfr725	G	A	14: 50,034,987	R139C	probably benign	Het
Papd4	A	T	13: 93,175,738	C180*	probably null	Het
Papln	A	G	12: 83,771,878	E78G	probably null	Het
Phldb3	T	C	7: 24,626,722		probably null	Het
Pkd1l2	A	G	8: 116,997,582	I2394T	probably damaging	Het
Ppa2	A	T	3: 133,330,439	N118I	probably damaging	Het
Ppef2	A	T	5: 92,250,529	C43*	probably null	Het
Rab27a	G	A	9: 73,085,039		probably null	Het
Rabgap1l	A	T	1: 160,342,113	F47I	probably damaging	Het
Rala	A	G	13: 17,893,161	I95T	probably damaging	Het
Rgl2	A	G	17: 33,932,717	D245G	probably benign	Het
Rnf34	A	T	5: 122,864,083	T35S	probably damaging	Het
Ros1	C	T	10: 52,181,798	R51Q	probably benign	Het
Samd9l	T	C	6: 3,372,716	D1515G	possibly damaging	Het
Scn7a	T	C	2: 66,675,526	E1673G	probably benign	Het
Slc6a20a	A	C	9: 123,641,708		probably null	Het
Tdrd5	A	T	1: 156,294,500	S280T	probably damaging	Het
Tie1	T	C	4: 118,475,603	I911V	possibly damaging	Het
Vipas39	G	A	12: 87,251,807	R194*	probably null	Het
Ybx3	A	C	6: 131,368,488	N307K	possibly damaging	Het
Ylpm1	A	T	12: 85,042,125	H1216L	probably damaging	Het

Other mutations in Myo1f

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00851:Myo1f	APN	17	33581964	missense	probably benign	0.01
IGL01019:Myo1f	APN	17	33593003	missense	possibly damaging	0.93
IGL01524:Myo1f	APN	17	33579883	missense	probably damaging	1.00
IGL01744:Myo1f	APN	17	33583680	splice site	probably benign
IGL01951:Myo1f	APN	17	33598017	missense	possibly damaging	0.64
IGL02132:Myo1f	APN	17	33579971	missense	probably benign	0.10
IGL02170:Myo1f	APN	17	33578272	missense	probably benign	0.14
IGL02173:Myo1f	APN	17	33607344	missense	probably damaging	1.00
IGL02277:Myo1f	APN	17	33579861	splice site	probably null
IGL02550:Myo1f	APN	17	33588142	missense	probably damaging	1.00
IGL02550:Myo1f	APN	17	33580150	unclassified	probably benign
IGL02615:Myo1f	APN	17	33604656	missense	probably benign
IGL02801:Myo1f	APN	17	33578137	missense	probably damaging	1.00
IGL02817:Myo1f	APN	17	33604558	missense	probably benign	0.06
IGL02904:Myo1f	APN	17	33585658	nonsense	probably null
IGL03056:Myo1f	APN	17	33585600	missense	probably damaging	1.00
IGL03334:Myo1f	APN	17	33598194	missense	probably damaging	1.00
R0066:Myo1f	UTSW	17	33601703	missense	probably damaging	0.98
R0066:Myo1f	UTSW	17	33601703	missense	probably damaging	0.98
R0321:Myo1f	UTSW	17	33593012	missense	probably benign	0.31
R0375:Myo1f	UTSW	17	33601956	missense	probably benign	0.27
R0487:Myo1f	UTSW	17	33578284	missense	probably damaging	1.00
R0925:Myo1f	UTSW	17	33578133	missense	probably damaging	0.96
R1394:Myo1f	UTSW	17	33583740	missense	probably damaging	0.96
R1395:Myo1f	UTSW	17	33583740	missense	probably damaging	0.96
R1474:Myo1f	UTSW	17	33594027	missense	possibly damaging	0.77
R1760:Myo1f	UTSW	17	33586198	missense	probably benign	0.03
R1965:Myo1f	UTSW	17	33598172	nonsense	probably null
R2409:Myo1f	UTSW	17	33576667	missense	probably damaging	1.00
R2432:Myo1f	UTSW	17	33575849	missense	probably damaging	1.00
R4610:Myo1f	UTSW	17	33582332	missense	probably damaging	1.00
R4785:Myo1f	UTSW	17	33598191	missense	possibly damaging	0.95
R5239:Myo1f	UTSW	17	33601735	missense	probably benign	0.00
R5881:Myo1f	UTSW	17	33576653	missense	probably damaging	1.00
R6160:Myo1f	UTSW	17	33604344	missense	probably benign
R6210:Myo1f	UTSW	17	33601070	missense	probably damaging	1.00
R6365:Myo1f	UTSW	17	33586116	missense	probably benign
R6464:Myo1f	UTSW	17	33576647	missense	probably damaging	1.00
R6532:Myo1f	UTSW	17	33575846	missense	probably damaging	1.00
R6678:Myo1f	UTSW	17	33575845	missense	probably damaging	1.00
R7241:Myo1f	UTSW	17	33579928	missense	probably damaging	0.99
R7266:Myo1f	UTSW	17	33601694	missense	probably benign
R7513:Myo1f	UTSW	17	33575814	missense	probably damaging	1.00
R7606:Myo1f	UTSW	17	33576450	missense	probably damaging	1.00
R7779:Myo1f	UTSW	17	33578273	missense	probably benign	0.27
R7853:Myo1f	UTSW	17	33576698	missense	probably damaging	1.00
R7884:Myo1f	UTSW	17	33598296	missense	probably damaging	1.00
R8507:Myo1f	UTSW	17	33598018	missense	probably benign	0.09
X0028:Myo1f	UTSW	17	33576438	missense	possibly damaging	0.67
X0065:Myo1f	UTSW	17	33601983	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- ATCTACTACCAGGTGCGTGG -3'
(R):5'- GGCATTTTACCCACTGAGCC -3'

Sequencing Primer
(F):5'- CGAAGGTAAGGCAACCACTATG -3'
(R):5'- ACCCACTGAGCCATTCCTTG -3'

Posted On

2017-02-10