Mutagenetix > Incidental Mutation

Incidental Mutation 'R0555:Lrit3'

45445

Institutional Source

Beutler Lab

Gene Symbol

Lrit3

Ensembl Gene

ENSMUSG00000093865

Gene Name

leucine-rich repeat, immunoglobulin-like and transmembrane domains 3

Synonyms

LOC242235

MMRRC Submission

038747-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0555 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

129787881-129804030 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 129791296 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Aspartic acid at position 271 (V271D)

Ref Sequence

ENSEMBL: ENSMUSP00000140184 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000179187] [ENSMUST00000185462]

AlphaFold

W8DXL4

Predicted Effect

probably damaging
Transcript: ENSMUST00000179187
AA Change: V271D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000136912
Gene: ENSMUSG00000093865
AA Change: V271D

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
LRRNT	20	61	2.7e-1	SMART
LRR	80	103	6.96e0	SMART
LRR	104	127	3.27e1	SMART
LRR_TYP	128	151	4.47e-3	SMART
LRR_TYP	152	175	7.37e-4	SMART
LRRCT	201	252	4.65e-2	SMART
Blast:IG	260	297	9e-13	BLAST
low complexity region	298	311	N/A	INTRINSIC
FN3	364	443	1.85e0	SMART
transmembrane domain	462	484	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000185462
AA Change: V271D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000140184
Gene: ENSMUSG00000093865
AA Change: V271D

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
LRRNT	20	61	1.3e-3	SMART
LRR	80	103	2.9e-2	SMART
LRR	104	127	1.4e-1	SMART
LRR_TYP	128	151	1.9e-5	SMART
LRR_TYP	152	175	3.2e-6	SMART
LRRCT	201	252	2.3e-4	SMART
IGc2	266	335	4.7e-11	SMART
low complexity region	340	352	N/A	INTRINSIC
low complexity region	362	376	N/A	INTRINSIC
low complexity region	408	432	N/A	INTRINSIC
FN3	485	564	9e-3	SMART
transmembrane domain	583	605	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000188978

Meta Mutation Damage Score

0.6794

Coding Region Coverage

1x: 99.6%
3x: 98.8%
10x: 96.9%
20x: 93.8%

Validation Efficiency

100% (98/98)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that has a fibronectin type III domain and a C-terminal transmembrane domain, as well as a leucine-rich repeat domain and immunoglobulin-like domain near the N-terminus. The encoded protein may regulate fibroblast growth factor receptors and affect the modification of these receptors, which are glycosylated differently in the Golgi and endoplasmic reticulum. Mutations in this gene are associated with congenital stationary night blindness, type 1F. [provided by RefSeq, May 2013]
PHENOTYPE: Mice homozygous for a targeted allele show a selective absence of the ERG b-wave with a normal a-wave component under scotopic conditions, as well as variable ERG responses with larger a-wave amplitudes, shorter b-wave amplitudes, and longer implicit times of both waves under photopic conditions. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 96 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam10	T	A	9: 70,754,234	I363N	probably damaging	Het
Ahcyl2	T	C	6: 29,890,671		probably benign	Het
Asap1	A	G	15: 64,094,364	L941P	probably damaging	Het
Aurka	G	A	2: 172,367,147	R23C	probably benign	Het
Cacna1c	C	T	6: 118,612,625	R1446H	probably damaging	Het
Casp8ap2	T	A	4: 32,640,381	H478Q	probably damaging	Het
Clcn4	C	T	7: 7,290,504	A418T	possibly damaging	Het
Cpxm2	A	T	7: 132,044,043	Y715*	probably null	Het
Csmd1	T	C	8: 16,185,273	M1179V	probably benign	Het
Ddx21	A	T	10: 62,587,528	F632I	probably damaging	Het
Dnaic1	C	A	4: 41,625,335	T433K	possibly damaging	Het
Dpyd	G	A	3: 119,431,542	G988D	probably damaging	Het
Dync1i2	AAAAGAAGAGGAAAGAAGAGGAAAG	AAAAGAAGAGGAAAG	2: 71,214,518		probably null	Het
Dync1li2	A	T	8: 104,420,665	S466T	probably benign	Het
Ears2	T	C	7: 122,048,444	T206A	probably benign	Het
Elmod1	A	T	9: 53,931,592		probably benign	Het
Eps8l3	C	A	3: 107,892,345	D590E	probably benign	Het
Etfdh	A	T	3: 79,605,805	H370Q	probably benign	Het
Fam83g	C	A	11: 61,707,663	A792E	probably benign	Het
Ffar3	G	T	7: 30,855,537	Y119*	probably null	Het
Fosb	G	T	7: 19,307,213	S118R	possibly damaging	Het
Foxn4	G	A	5: 114,263,114	L3F	probably damaging	Het
Foxo4	A	G	X: 101,255,178	K65E	probably damaging	Het
Frem2	A	G	3: 53,516,860	L3052P	probably damaging	Het
Fubp3	G	A	2: 31,608,137	R101H	probably damaging	Het
Gba2	C	A	4: 43,569,927	G429C	probably damaging	Het
Gimap1	T	C	6: 48,741,429		probably benign	Het
Gm17657	A	T	17: 29,519,571	F74I	probably benign	Het
Gnas	A	G	2: 174,298,511	T158A	possibly damaging	Het
Gpc5	T	C	14: 115,552,328	V538A	probably damaging	Het
Greb1l	T	C	18: 10,458,781		probably benign	Het
H2-M10.5	G	A	17: 36,774,728	G260R	probably damaging	Het
Hbs1l	A	C	10: 21,349,323	Q412H	probably benign	Het
Hecw1	G	T	13: 14,236,941	T1058N	probably damaging	Het
Heph	A	T	X: 96,558,084	T1027S	probably damaging	Het
Hoga1	A	C	19: 42,046,075	E53A	possibly damaging	Het
Insrr	T	G	3: 87,814,437		probably benign	Het
Ipo11	A	T	13: 106,892,461	V328D	probably damaging	Het
Jakmip1	T	C	5: 37,118,873	V509A	probably damaging	Het
Jmjd1c	T	C	10: 67,225,789	V1307A	probably benign	Het
Kmt2a	T	A	9: 44,847,571	S1027C	probably damaging	Het
Kprp	G	C	3: 92,824,357	P462R	unknown	Het
Lman1l	T	C	9: 57,614,101	T193A	probably benign	Het
Map4	T	A	9: 109,979,103		probably benign	Het
Mark4	A	C	7: 19,448,673		probably benign	Het
Mfsd14b	A	G	13: 65,078,445	V142A	probably benign	Het
Mis18bp1	A	T	12: 65,161,453	I162N	possibly damaging	Het
Mrpl43	A	T	19: 45,005,952		probably benign	Het
Mrpl47	A	G	3: 32,736,693	F16S	probably benign	Het
Myh2	G	T	11: 67,178,967	G380C	probably damaging	Het
Myo15	T	C	11: 60,521,638	Y3284H	probably damaging	Het
Nectin2	A	G	7: 19,733,223		probably benign	Het
Neu3	A	G	7: 99,814,183	V111A	probably damaging	Het
Nol4l	T	C	2: 153,417,684		probably null	Het
Nphp3	C	A	9: 104,023,434	H510Q	probably damaging	Het
Nprl3	T	A	11: 32,233,118		probably null	Het
Olfr292	A	G	7: 86,695,308	N284S	probably damaging	Het
Olfr48	T	C	2: 89,844,443	T177A	probably benign	Het
Olfr598	T	C	7: 103,328,963	V159A	probably benign	Het
Olfr791	T	C	10: 129,526,896	I223T	possibly damaging	Het
Pex1	A	G	5: 3,606,130	E319G	possibly damaging	Het
Phtf1	C	A	3: 104,004,469	T709K	probably damaging	Het
Plek2	A	T	12: 78,892,172	L271Q	probably damaging	Het
Plekhg5	T	A	4: 152,107,469	C421*	probably null	Het
Polk	A	C	13: 96,484,179	C525W	probably damaging	Het
Ppfibp2	T	C	7: 107,729,174	S471P	probably damaging	Het
Prickle2	A	T	6: 92,458,565	F74L	probably benign	Het
Prl7d1	A	T	13: 27,712,055	V113D	probably benign	Het
Prr14	C	T	7: 127,472,095		probably benign	Het
Ptpro	T	A	6: 137,443,594	V1007D	probably damaging	Het
Ret	A	G	6: 118,178,610	V375A	probably damaging	Het
Rora	T	C	9: 69,361,746	F41S	probably damaging	Het
Sall1	T	C	8: 89,031,758	T573A	probably benign	Het
Shb	A	G	4: 45,458,321	V281A	possibly damaging	Het
Slc25a26	A	T	6: 94,592,410		probably null	Het
Sltm	T	C	9: 70,586,081	F769L	probably damaging	Het
Snx9	T	A	17: 5,918,413	M328K	probably damaging	Het
Stk25	G	T	1: 93,624,591	Q356K	probably benign	Het
Svep1	T	A	4: 58,128,858	Y613F	possibly damaging	Het
Syne4	G	A	7: 30,316,744	A195T	probably damaging	Het
Tmem8	T	C	17: 26,117,114	L130S	probably benign	Het
Trcg1	C	T	9: 57,242,333	T396M	probably damaging	Het
Trim30b	A	G	7: 104,357,298	V117A	possibly damaging	Het
Trpc4	T	C	3: 54,302,090		probably benign	Het
Ttll4	A	G	1: 74,688,280	H827R	probably damaging	Het
Urgcp	T	C	11: 5,717,477	E287G	probably damaging	Het
Usp2	G	T	9: 44,092,784	L319F	probably damaging	Het
Vmn1r167	A	T	7: 23,505,087	V168D	probably damaging	Het
Vmn2r100	C	A	17: 19,522,120	P252Q	possibly damaging	Het
Vmn2r61	A	T	7: 42,266,018	I130F	probably benign	Het
Vmn2r63	A	T	7: 42,928,528	Y195*	probably null	Het
Vmn2r81	T	C	10: 79,293,449	S725P	probably damaging	Het
Wnt10b	A	G	15: 98,772,937		probably benign	Het
Zcchc6	A	G	13: 59,800,317	V328A	probably benign	Het
Zfp292	T	C	4: 34,807,194	E1950G	probably damaging	Het
Zfyve16	A	G	13: 92,516,520		probably benign	Het

Other mutations in Lrit3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
FR4304:Lrit3	UTSW	3	129788819	small insertion	probably benign
FR4340:Lrit3	UTSW	3	129788808	small insertion	probably benign
FR4548:Lrit3	UTSW	3	129788813	small insertion	probably benign
FR4548:Lrit3	UTSW	3	129788816	small insertion	probably benign
FR4589:Lrit3	UTSW	3	129803913	frame shift	probably null
FR4737:Lrit3	UTSW	3	129788806	small insertion	probably benign
FR4737:Lrit3	UTSW	3	129788810	small insertion	probably benign
FR4737:Lrit3	UTSW	3	129803913	frame shift	probably null
FR4976:Lrit3	UTSW	3	129803910	unclassified	probably benign
R0629:Lrit3	UTSW	3	129788302	missense	probably damaging	1.00
R0631:Lrit3	UTSW	3	129788555	missense	probably damaging	1.00
R1690:Lrit3	UTSW	3	129800745	missense	probably damaging	0.99
R1902:Lrit3	UTSW	3	129791246	missense	probably benign	0.17
R1955:Lrit3	UTSW	3	129800481	missense	probably benign	0.11
R3155:Lrit3	UTSW	3	129791395	missense	probably benign	0.00
R4005:Lrit3	UTSW	3	129791372	missense	probably benign	0.14
R4445:Lrit3	UTSW	3	129788531	nonsense	probably null
R4675:Lrit3	UTSW	3	129788472	missense	probably damaging	1.00
R5104:Lrit3	UTSW	3	129788391	missense	possibly damaging	0.86
R5147:Lrit3	UTSW	3	129803925	missense	possibly damaging	0.78
R5271:Lrit3	UTSW	3	129788301	missense	probably damaging	1.00
R5505:Lrit3	UTSW	3	129791438	missense	possibly damaging	0.83
R5587:Lrit3	UTSW	3	129788898	missense	probably benign	0.25
R6056:Lrit3	UTSW	3	129789355	missense	probably damaging	1.00
R6239:Lrit3	UTSW	3	129800346	missense	probably damaging	0.98
R6280:Lrit3	UTSW	3	129788763	missense	probably damaging	0.99
R6305:Lrit3	UTSW	3	129800460	missense	probably damaging	0.98
R6441:Lrit3	UTSW	3	129800360	missense	probably benign
R6947:Lrit3	UTSW	3	129789234	missense	probably benign	0.01
R6949:Lrit3	UTSW	3	129789285	missense	probably damaging	1.00
R7850:Lrit3	UTSW	3	129800803	missense	probably damaging	1.00
R8157:Lrit3	UTSW	3	129800635	missense	probably benign	0.00
R8405:Lrit3	UTSW	3	129788652	missense	probably benign	0.26
R8896:Lrit3	UTSW	3	129791483	missense	probably damaging	1.00
R8937:Lrit3	UTSW	3	129800544	missense	probably damaging	1.00
R9794:Lrit3	UTSW	3	129800424	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGACAACAACCCATGTCCTTGCATC -3'
(R):5'- TCTGTCACAAGACAAGCTGTGCTG -3'

Sequencing Primer
(F):5'- GCATCCAATGATCTTGGTGTTATTAC -3'
(R):5'- CATTTCCAAGGTGATCGAGC -3'

Posted On

2013-06-11