Incidental Mutation 'R0555:Lrit3'
ID45445
Institutional Source Beutler Lab
Gene Symbol Lrit3
Ensembl Gene ENSMUSG00000093865
Gene Nameleucine-rich repeat, immunoglobulin-like and transmembrane domains 3
SynonymsLOC242235
MMRRC Submission 038747-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0555 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location129787881-129804030 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 129791296 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 271 (V271D)
Ref Sequence ENSEMBL: ENSMUSP00000140184 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000179187] [ENSMUST00000185462]
Predicted Effect probably damaging
Transcript: ENSMUST00000179187
AA Change: V271D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000136912
Gene: ENSMUSG00000093865
AA Change: V271D

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
LRRNT 20 61 2.7e-1 SMART
LRR 80 103 6.96e0 SMART
LRR 104 127 3.27e1 SMART
LRR_TYP 128 151 4.47e-3 SMART
LRR_TYP 152 175 7.37e-4 SMART
LRRCT 201 252 4.65e-2 SMART
Blast:IG 260 297 9e-13 BLAST
low complexity region 298 311 N/A INTRINSIC
FN3 364 443 1.85e0 SMART
transmembrane domain 462 484 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000185462
AA Change: V271D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140184
Gene: ENSMUSG00000093865
AA Change: V271D

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
LRRNT 20 61 1.3e-3 SMART
LRR 80 103 2.9e-2 SMART
LRR 104 127 1.4e-1 SMART
LRR_TYP 128 151 1.9e-5 SMART
LRR_TYP 152 175 3.2e-6 SMART
LRRCT 201 252 2.3e-4 SMART
IGc2 266 335 4.7e-11 SMART
low complexity region 340 352 N/A INTRINSIC
low complexity region 362 376 N/A INTRINSIC
low complexity region 408 432 N/A INTRINSIC
FN3 485 564 9e-3 SMART
transmembrane domain 583 605 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188978
Meta Mutation Damage Score 0.6794 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.8%
  • 10x: 96.9%
  • 20x: 93.8%
Validation Efficiency 100% (98/98)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that has a fibronectin type III domain and a C-terminal transmembrane domain, as well as a leucine-rich repeat domain and immunoglobulin-like domain near the N-terminus. The encoded protein may regulate fibroblast growth factor receptors and affect the modification of these receptors, which are glycosylated differently in the Golgi and endoplasmic reticulum. Mutations in this gene are associated with congenital stationary night blindness, type 1F. [provided by RefSeq, May 2013]
PHENOTYPE: Mice homozygous for a targeted allele show a selective absence of the ERG b-wave with a normal a-wave component under scotopic conditions, as well as variable ERG responses with larger a-wave amplitudes, shorter b-wave amplitudes, and longer implicit times of both waves under photopic conditions. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 96 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam10 T A 9: 70,754,234 I363N probably damaging Het
Ahcyl2 T C 6: 29,890,671 probably benign Het
Asap1 A G 15: 64,094,364 L941P probably damaging Het
Aurka G A 2: 172,367,147 R23C probably benign Het
Cacna1c C T 6: 118,612,625 R1446H probably damaging Het
Casp8ap2 T A 4: 32,640,381 H478Q probably damaging Het
Clcn4 C T 7: 7,290,504 A418T possibly damaging Het
Cpxm2 A T 7: 132,044,043 Y715* probably null Het
Csmd1 T C 8: 16,185,273 M1179V probably benign Het
Ddx21 A T 10: 62,587,528 F632I probably damaging Het
Dnaic1 C A 4: 41,625,335 T433K possibly damaging Het
Dpyd G A 3: 119,431,542 G988D probably damaging Het
Dync1i2 AAAAGAAGAGGAAAGAAGAGGAAAG AAAAGAAGAGGAAAG 2: 71,214,518 probably null Het
Dync1li2 A T 8: 104,420,665 S466T probably benign Het
Ears2 T C 7: 122,048,444 T206A probably benign Het
Elmod1 A T 9: 53,931,592 probably benign Het
Eps8l3 C A 3: 107,892,345 D590E probably benign Het
Etfdh A T 3: 79,605,805 H370Q probably benign Het
Fam83g C A 11: 61,707,663 A792E probably benign Het
Ffar3 G T 7: 30,855,537 Y119* probably null Het
Fosb G T 7: 19,307,213 S118R possibly damaging Het
Foxn4 G A 5: 114,263,114 L3F probably damaging Het
Foxo4 A G X: 101,255,178 K65E probably damaging Het
Frem2 A G 3: 53,516,860 L3052P probably damaging Het
Fubp3 G A 2: 31,608,137 R101H probably damaging Het
Gba2 C A 4: 43,569,927 G429C probably damaging Het
Gimap1 T C 6: 48,741,429 probably benign Het
Gm17657 A T 17: 29,519,571 F74I probably benign Het
Gnas A G 2: 174,298,511 T158A possibly damaging Het
Gpc5 T C 14: 115,552,328 V538A probably damaging Het
Greb1l T C 18: 10,458,781 probably benign Het
H2-M10.5 G A 17: 36,774,728 G260R probably damaging Het
Hbs1l A C 10: 21,349,323 Q412H probably benign Het
Hecw1 G T 13: 14,236,941 T1058N probably damaging Het
Heph A T X: 96,558,084 T1027S probably damaging Het
Hoga1 A C 19: 42,046,075 E53A possibly damaging Het
Insrr T G 3: 87,814,437 probably benign Het
Ipo11 A T 13: 106,892,461 V328D probably damaging Het
Jakmip1 T C 5: 37,118,873 V509A probably damaging Het
Jmjd1c T C 10: 67,225,789 V1307A probably benign Het
Kmt2a T A 9: 44,847,571 S1027C probably damaging Het
Kprp G C 3: 92,824,357 P462R unknown Het
Lman1l T C 9: 57,614,101 T193A probably benign Het
Map4 T A 9: 109,979,103 probably benign Het
Mark4 A C 7: 19,448,673 probably benign Het
Mfsd14b A G 13: 65,078,445 V142A probably benign Het
Mis18bp1 A T 12: 65,161,453 I162N possibly damaging Het
Mrpl43 A T 19: 45,005,952 probably benign Het
Mrpl47 A G 3: 32,736,693 F16S probably benign Het
Myh2 G T 11: 67,178,967 G380C probably damaging Het
Myo15 T C 11: 60,521,638 Y3284H probably damaging Het
Nectin2 A G 7: 19,733,223 probably benign Het
Neu3 A G 7: 99,814,183 V111A probably damaging Het
Nol4l T C 2: 153,417,684 probably null Het
Nphp3 C A 9: 104,023,434 H510Q probably damaging Het
Nprl3 T A 11: 32,233,118 probably null Het
Olfr292 A G 7: 86,695,308 N284S probably damaging Het
Olfr48 T C 2: 89,844,443 T177A probably benign Het
Olfr598 T C 7: 103,328,963 V159A probably benign Het
Olfr791 T C 10: 129,526,896 I223T possibly damaging Het
Pex1 A G 5: 3,606,130 E319G possibly damaging Het
Phtf1 C A 3: 104,004,469 T709K probably damaging Het
Plek2 A T 12: 78,892,172 L271Q probably damaging Het
Plekhg5 T A 4: 152,107,469 C421* probably null Het
Polk A C 13: 96,484,179 C525W probably damaging Het
Ppfibp2 T C 7: 107,729,174 S471P probably damaging Het
Prickle2 A T 6: 92,458,565 F74L probably benign Het
Prl7d1 A T 13: 27,712,055 V113D probably benign Het
Prr14 C T 7: 127,472,095 probably benign Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Ret A G 6: 118,178,610 V375A probably damaging Het
Rora T C 9: 69,361,746 F41S probably damaging Het
Sall1 T C 8: 89,031,758 T573A probably benign Het
Shb A G 4: 45,458,321 V281A possibly damaging Het
Slc25a26 A T 6: 94,592,410 probably null Het
Sltm T C 9: 70,586,081 F769L probably damaging Het
Snx9 T A 17: 5,918,413 M328K probably damaging Het
Stk25 G T 1: 93,624,591 Q356K probably benign Het
Svep1 T A 4: 58,128,858 Y613F possibly damaging Het
Syne4 G A 7: 30,316,744 A195T probably damaging Het
Tmem8 T C 17: 26,117,114 L130S probably benign Het
Trcg1 C T 9: 57,242,333 T396M probably damaging Het
Trim30b A G 7: 104,357,298 V117A possibly damaging Het
Trpc4 T C 3: 54,302,090 probably benign Het
Ttll4 A G 1: 74,688,280 H827R probably damaging Het
Urgcp T C 11: 5,717,477 E287G probably damaging Het
Usp2 G T 9: 44,092,784 L319F probably damaging Het
Vmn1r167 A T 7: 23,505,087 V168D probably damaging Het
Vmn2r100 C A 17: 19,522,120 P252Q possibly damaging Het
Vmn2r61 A T 7: 42,266,018 I130F probably benign Het
Vmn2r63 A T 7: 42,928,528 Y195* probably null Het
Vmn2r81 T C 10: 79,293,449 S725P probably damaging Het
Wnt10b A G 15: 98,772,937 probably benign Het
Zcchc6 A G 13: 59,800,317 V328A probably benign Het
Zfp292 T C 4: 34,807,194 E1950G probably damaging Het
Zfyve16 A G 13: 92,516,520 probably benign Het
Other mutations in Lrit3
AlleleSourceChrCoordTypePredicted EffectPPH Score
FR4304:Lrit3 UTSW 3 129788819 small insertion probably benign
FR4340:Lrit3 UTSW 3 129788808 small insertion probably benign
FR4548:Lrit3 UTSW 3 129788813 small insertion probably benign
FR4548:Lrit3 UTSW 3 129788816 small insertion probably benign
FR4589:Lrit3 UTSW 3 129803913 frame shift probably null
FR4737:Lrit3 UTSW 3 129788806 small insertion probably benign
FR4737:Lrit3 UTSW 3 129788810 small insertion probably benign
FR4737:Lrit3 UTSW 3 129803913 frame shift probably null
FR4976:Lrit3 UTSW 3 129803910 unclassified probably benign
R0629:Lrit3 UTSW 3 129788302 missense probably damaging 1.00
R0631:Lrit3 UTSW 3 129788555 missense probably damaging 1.00
R1690:Lrit3 UTSW 3 129800745 missense probably damaging 0.99
R1902:Lrit3 UTSW 3 129791246 missense probably benign 0.17
R1955:Lrit3 UTSW 3 129800481 missense probably benign 0.11
R3155:Lrit3 UTSW 3 129791395 missense probably benign 0.00
R4005:Lrit3 UTSW 3 129791372 missense probably benign 0.14
R4445:Lrit3 UTSW 3 129788531 nonsense probably null
R4675:Lrit3 UTSW 3 129788472 missense probably damaging 1.00
R5104:Lrit3 UTSW 3 129788391 missense possibly damaging 0.86
R5147:Lrit3 UTSW 3 129803925 missense possibly damaging 0.78
R5271:Lrit3 UTSW 3 129788301 missense probably damaging 1.00
R5505:Lrit3 UTSW 3 129791438 missense possibly damaging 0.83
R5587:Lrit3 UTSW 3 129788898 missense probably benign 0.25
R6056:Lrit3 UTSW 3 129789355 missense probably damaging 1.00
R6239:Lrit3 UTSW 3 129800346 missense probably damaging 0.98
R6280:Lrit3 UTSW 3 129788763 missense probably damaging 0.99
R6305:Lrit3 UTSW 3 129800460 missense probably damaging 0.98
R6441:Lrit3 UTSW 3 129800360 missense probably benign
R6947:Lrit3 UTSW 3 129789234 missense probably benign 0.01
R6949:Lrit3 UTSW 3 129789285 missense probably damaging 1.00
R7850:Lrit3 UTSW 3 129800803 missense probably damaging 1.00
R8157:Lrit3 UTSW 3 129800635 missense probably benign 0.00
R8405:Lrit3 UTSW 3 129788652 missense probably benign 0.26
Predicted Primers PCR Primer
(F):5'- TGACAACAACCCATGTCCTTGCATC -3'
(R):5'- TCTGTCACAAGACAAGCTGTGCTG -3'

Sequencing Primer
(F):5'- GCATCCAATGATCTTGGTGTTATTAC -3'
(R):5'- CATTTCCAAGGTGATCGAGC -3'
Posted On2013-06-11