Incidental Mutation 'R5881:Rgl2'
ID 454450
Institutional Source Beutler Lab
Gene Symbol Rgl2
Ensembl Gene ENSMUSG00000041354
Gene Name ral guanine nucleotide dissociation stimulator-like 2
Synonyms KE1.5, Rab2l, Rgt2, Rlf
MMRRC Submission 044085-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.104) question?
Stock # R5881 (G1)
Quality Score 225
Status Not validated
Chromosome 17
Chromosomal Location 33929543-33937687 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 33932717 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 245 (D245G)
Ref Sequence ENSEMBL: ENSMUSP00000041082 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025161] [ENSMUST00000047503]
AlphaFold Q61193
PDB Structure STRUCTURE DETERMINATION OF THE RAS-BINDING DOMAIN OF THE RAL-SPECIFIC GUANINE NUCLEOTIDE EXCHANGE FACTOR RLF, NMR, 10 STRUCTURES [SOLUTION NMR]
The conformation of a docking site for SH3 domains is pre-selected in the Guanine Nucleotide Exchange Factor Rlf [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000025161
SMART Domains Protein: ENSMUSP00000025161
Gene: ENSMUSG00000024308

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 48 65 N/A INTRINSIC
low complexity region 127 152 N/A INTRINSIC
IG 168 292 3.45e0 SMART
IG_like 302 406 4.78e1 SMART
transmembrane domain 416 438 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000047503
AA Change: D245G

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000041082
Gene: ENSMUSG00000041354
AA Change: D245G

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
low complexity region 31 42 N/A INTRINSIC
low complexity region 44 63 N/A INTRINSIC
RasGEFN 87 212 9.54e-30 SMART
RasGEF 239 514 7.15e-106 SMART
low complexity region 578 592 N/A INTRINSIC
low complexity region 602 619 N/A INTRINSIC
low complexity region 633 648 N/A INTRINSIC
RA 649 736 2.05e-19 SMART
low complexity region 737 762 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172468
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172653
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173153
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173258
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173266
Predicted Effect probably benign
Transcript: ENSMUST00000173284
SMART Domains Protein: ENSMUSP00000134312
Gene: ENSMUSG00000041354

DomainStartEndE-ValueType
Blast:RasGEF 2 67 1e-35 BLAST
PDB:4JGW|B 2 67 1e-35 PDB
SCOP:d1bkds_ 2 94 3e-16 SMART
low complexity region 131 145 N/A INTRINSIC
low complexity region 155 172 N/A INTRINSIC
low complexity region 186 201 N/A INTRINSIC
RA 202 289 2.05e-19 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173379
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173502
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173718
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174410
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174442
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174676
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.3%
  • 10x: 94.5%
  • 20x: 78.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abi3 A C 11: 95,834,387 L159W probably damaging Het
Abi3 A T 11: 95,834,388 L159M probably damaging Het
Adam11 A C 11: 102,773,810 I406L probably benign Het
Ager G T 17: 34,600,077 V300L probably damaging Het
Ank3 C T 10: 69,986,830 S1726L probably benign Het
Boc A G 16: 44,490,651 I740T probably damaging Het
C8a T A 4: 104,853,932 D178V probably damaging Het
Ces3a G A 8: 105,050,566 V174M probably damaging Het
Cisd1 A T 10: 71,336,414 W13R probably damaging Het
Commd8 A T 5: 72,162,764 D111E probably benign Het
Ddx60 A T 8: 62,037,070 D1691V probably damaging Het
Desi2 A G 1: 178,237,913 Y15C probably damaging Het
Dnmt1 A G 9: 20,952,717 V24A probably damaging Het
Dock10 G A 1: 80,560,923 T968M probably benign Het
Dsel A T 1: 111,859,438 F1122L probably damaging Het
Eml3 T C 19: 8,933,443 F220L probably damaging Het
Entpd2 A C 2: 25,400,812 N443H probably damaging Het
Epgn A G 5: 91,028,363 N36S probably benign Het
Fsip2 G T 2: 82,984,441 S3506I possibly damaging Het
Gm10436 A G 12: 88,176,341 L169P probably damaging Het
Gprin3 T C 6: 59,354,786 S179G probably benign Het
Grifin G T 5: 140,563,587 H125N possibly damaging Het
Hils1 A G 11: 94,968,163 T95A possibly damaging Het
Hmcn1 A G 1: 150,630,327 V3816A probably damaging Het
Hspa14 A G 2: 3,498,170 F196L probably benign Het
Ice1 T C 13: 70,606,501 K489E probably benign Het
Jmjd6 C T 11: 116,839,856 W117* probably null Het
Lrit2 G T 14: 37,072,235 A419S probably benign Het
Mc3r T C 2: 172,249,172 S105P probably benign Het
Mccc1 A G 3: 35,964,382 V601A probably benign Het
Myo1f A G 17: 33,576,653 D91G probably damaging Het
Myo1f G A 17: 33,580,285 E255K possibly damaging Het
Necap1 T A 6: 122,881,544 D115E probably benign Het
Olfr1271 A T 2: 90,266,442 probably null Het
Olfr65 T A 7: 103,906,676 M79K probably damaging Het
Olfr725 G A 14: 50,034,987 R139C probably benign Het
Papd4 A T 13: 93,175,738 C180* probably null Het
Papln A G 12: 83,771,878 E78G probably null Het
Phldb3 T C 7: 24,626,722 probably null Het
Pkd1l2 A G 8: 116,997,582 I2394T probably damaging Het
Ppa2 A T 3: 133,330,439 N118I probably damaging Het
Ppef2 A T 5: 92,250,529 C43* probably null Het
Rab27a G A 9: 73,085,039 probably null Het
Rabgap1l A T 1: 160,342,113 F47I probably damaging Het
Rala A G 13: 17,893,161 I95T probably damaging Het
Rnf34 A T 5: 122,864,083 T35S probably damaging Het
Ros1 C T 10: 52,181,798 R51Q probably benign Het
Samd9l T C 6: 3,372,716 D1515G possibly damaging Het
Scn7a T C 2: 66,675,526 E1673G probably benign Het
Slc6a20a A C 9: 123,641,708 probably null Het
Tdrd5 A T 1: 156,294,500 S280T probably damaging Het
Tie1 T C 4: 118,475,603 I911V possibly damaging Het
Vipas39 G A 12: 87,251,807 R194* probably null Het
Ybx3 A C 6: 131,368,488 N307K possibly damaging Het
Ylpm1 A T 12: 85,042,125 H1216L probably damaging Het
Other mutations in Rgl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00514:Rgl2 APN 17 33933136 missense probably benign 0.31
IGL00898:Rgl2 APN 17 33933418 missense possibly damaging 0.95
IGL00965:Rgl2 APN 17 33935936 missense probably benign 0.00
IGL00985:Rgl2 APN 17 33932101 missense probably damaging 1.00
IGL02140:Rgl2 APN 17 33933124 missense probably damaging 1.00
IGL02214:Rgl2 APN 17 33935189 missense probably benign 0.06
IGL02486:Rgl2 APN 17 33935980 missense probably damaging 0.97
IGL02579:Rgl2 APN 17 33937160 missense probably benign 0.08
IGL02976:Rgl2 APN 17 33933962 missense possibly damaging 0.95
Hypotenuse UTSW 17 33931739 missense probably benign 0.00
Pedernales UTSW 17 33932038 critical splice acceptor site probably null
PIT4354001:Rgl2 UTSW 17 33933940 missense possibly damaging 0.80
R0347:Rgl2 UTSW 17 33932738 missense probably damaging 1.00
R0456:Rgl2 UTSW 17 33936849 splice site probably null
R0825:Rgl2 UTSW 17 33935159 splice site probably null
R1742:Rgl2 UTSW 17 33937223 splice site probably null
R1777:Rgl2 UTSW 17 33931744 missense probably benign 0.00
R1829:Rgl2 UTSW 17 33933621 missense probably benign 0.00
R1908:Rgl2 UTSW 17 33932148 missense probably benign 0.00
R1961:Rgl2 UTSW 17 33933615 missense probably damaging 1.00
R2102:Rgl2 UTSW 17 33933340 splice site probably null
R3001:Rgl2 UTSW 17 33932605 missense probably benign 0.00
R3002:Rgl2 UTSW 17 33932605 missense probably benign 0.00
R3755:Rgl2 UTSW 17 33932597 missense probably benign 0.01
R3756:Rgl2 UTSW 17 33932597 missense probably benign 0.01
R3978:Rgl2 UTSW 17 33935162 missense probably benign 0.02
R4042:Rgl2 UTSW 17 33937262 missense probably damaging 1.00
R4064:Rgl2 UTSW 17 33937108 missense possibly damaging 0.77
R4204:Rgl2 UTSW 17 33936932 missense probably benign 0.04
R4661:Rgl2 UTSW 17 33933226 missense possibly damaging 0.77
R4852:Rgl2 UTSW 17 33937173 missense probably benign 0.00
R4922:Rgl2 UTSW 17 33932775 unclassified probably benign
R5119:Rgl2 UTSW 17 33937120 missense probably benign 0.00
R5167:Rgl2 UTSW 17 33935974 nonsense probably null
R5279:Rgl2 UTSW 17 33935948 missense probably benign
R5319:Rgl2 UTSW 17 33933555 missense probably benign 0.02
R5337:Rgl2 UTSW 17 33934984 missense probably damaging 0.99
R5945:Rgl2 UTSW 17 33932038 critical splice acceptor site probably null
R6165:Rgl2 UTSW 17 33931765 missense probably benign 0.01
R6358:Rgl2 UTSW 17 33937131 splice site probably null
R6867:Rgl2 UTSW 17 33932687 missense probably benign 0.09
R7174:Rgl2 UTSW 17 33934990 missense possibly damaging 0.93
R7182:Rgl2 UTSW 17 33934990 missense possibly damaging 0.93
R7183:Rgl2 UTSW 17 33934990 missense possibly damaging 0.93
R7184:Rgl2 UTSW 17 33934990 missense possibly damaging 0.93
R7196:Rgl2 UTSW 17 33933429 missense probably damaging 1.00
R7203:Rgl2 UTSW 17 33933429 missense probably damaging 1.00
R7250:Rgl2 UTSW 17 33933429 missense probably damaging 1.00
R7253:Rgl2 UTSW 17 33934990 missense possibly damaging 0.93
R7254:Rgl2 UTSW 17 33934990 missense possibly damaging 0.93
R7255:Rgl2 UTSW 17 33934990 missense possibly damaging 0.93
R7256:Rgl2 UTSW 17 33934990 missense possibly damaging 0.93
R7282:Rgl2 UTSW 17 33933429 missense probably damaging 1.00
R7455:Rgl2 UTSW 17 33932683 missense probably benign 0.32
R7513:Rgl2 UTSW 17 33932555 missense probably benign
R7752:Rgl2 UTSW 17 33935825 missense possibly damaging 0.82
R7901:Rgl2 UTSW 17 33935825 missense possibly damaging 0.82
R7941:Rgl2 UTSW 17 33931739 missense probably benign 0.00
R8158:Rgl2 UTSW 17 33936944 missense probably benign 0.27
R8209:Rgl2 UTSW 17 33932527 missense possibly damaging 0.91
R8226:Rgl2 UTSW 17 33932527 missense possibly damaging 0.91
R8405:Rgl2 UTSW 17 33933724 nonsense probably null
R8871:Rgl2 UTSW 17 33935000 missense probably damaging 1.00
R9205:Rgl2 UTSW 17 33936028 missense probably damaging 1.00
R9591:Rgl2 UTSW 17 33932477 missense possibly damaging 0.50
X0028:Rgl2 UTSW 17 33932458 splice site probably null
Predicted Primers PCR Primer
(F):5'- CTTGCTTCGGACAGGGTATG -3'
(R):5'- TCTGAGGCTCTTAAGTGGCC -3'

Sequencing Primer
(F):5'- TTCGGACAGGGTATGCAGCAC -3'
(R):5'- TCTTAAGTGGCCAGGGACCAG -3'
Posted On 2017-02-10