Incidental Mutation 'R5881:Eml3'
ID454453
Institutional Source Beutler Lab
Gene Symbol Eml3
Ensembl Gene ENSMUSG00000071647
Gene Nameechinoderm microtubule associated protein like 3
Synonyms
MMRRC Submission 044085-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.774) question?
Stock #R5881 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location8929552-8941582 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 8933443 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 220 (F220L)
Ref Sequence ENSEMBL: ENSMUSP00000093960 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096241] [ENSMUST00000096242] [ENSMUST00000224272] [ENSMUST00000224642]
Predicted Effect probably damaging
Transcript: ENSMUST00000096241
AA Change: F220L

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000093960
Gene: ENSMUSG00000071647
AA Change: F220L

DomainStartEndE-ValueType
coiled coil region 12 47 N/A INTRINSIC
low complexity region 96 108 N/A INTRINSIC
low complexity region 118 139 N/A INTRINSIC
low complexity region 149 168 N/A INTRINSIC
low complexity region 198 208 N/A INTRINSIC
Pfam:HELP 215 286 5.3e-30 PFAM
WD40 295 344 6.34e-2 SMART
Blast:WD40 347 392 5e-22 BLAST
WD40 395 434 1.56e-1 SMART
WD40 450 487 2.64e2 SMART
WD40 504 543 3.33e-1 SMART
WD40 587 626 2.69e-5 SMART
WD40 670 709 1.7e-2 SMART
WD40 716 755 1.52e-4 SMART
WD40 829 869 1.29e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000096242
SMART Domains Protein: ENSMUSP00000093961
Gene: ENSMUSG00000071648

DomainStartEndE-ValueType
low complexity region 3 11 N/A INTRINSIC
Pfam:Tetraspannin 17 291 1e-18 PFAM
low complexity region 331 346 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000224272
AA Change: F219L

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
Predicted Effect probably benign
Transcript: ENSMUST00000224642
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225054
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225181
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226096
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.3%
  • 10x: 94.5%
  • 20x: 78.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abi3 A C 11: 95,834,387 L159W probably damaging Het
Abi3 A T 11: 95,834,388 L159M probably damaging Het
Adam11 A C 11: 102,773,810 I406L probably benign Het
Ager G T 17: 34,600,077 V300L probably damaging Het
Ank3 C T 10: 69,986,830 S1726L probably benign Het
Boc A G 16: 44,490,651 I740T probably damaging Het
C8a T A 4: 104,853,932 D178V probably damaging Het
Ces3a G A 8: 105,050,566 V174M probably damaging Het
Cisd1 A T 10: 71,336,414 W13R probably damaging Het
Commd8 A T 5: 72,162,764 D111E probably benign Het
Ddx60 A T 8: 62,037,070 D1691V probably damaging Het
Desi2 A G 1: 178,237,913 Y15C probably damaging Het
Dnmt1 A G 9: 20,952,717 V24A probably damaging Het
Dock10 G A 1: 80,560,923 T968M probably benign Het
Dsel A T 1: 111,859,438 F1122L probably damaging Het
Entpd2 A C 2: 25,400,812 N443H probably damaging Het
Epgn A G 5: 91,028,363 N36S probably benign Het
Fsip2 G T 2: 82,984,441 S3506I possibly damaging Het
Gm10436 A G 12: 88,176,341 L169P probably damaging Het
Gprin3 T C 6: 59,354,786 S179G probably benign Het
Grifin G T 5: 140,563,587 H125N possibly damaging Het
Hils1 A G 11: 94,968,163 T95A possibly damaging Het
Hmcn1 A G 1: 150,630,327 V3816A probably damaging Het
Hspa14 A G 2: 3,498,170 F196L probably benign Het
Ice1 T C 13: 70,606,501 K489E probably benign Het
Jmjd6 C T 11: 116,839,856 W117* probably null Het
Lrit2 G T 14: 37,072,235 A419S probably benign Het
Mc3r T C 2: 172,249,172 S105P probably benign Het
Mccc1 A G 3: 35,964,382 V601A probably benign Het
Myo1f A G 17: 33,576,653 D91G probably damaging Het
Myo1f G A 17: 33,580,285 E255K possibly damaging Het
Necap1 T A 6: 122,881,544 D115E probably benign Het
Olfr1271 A T 2: 90,266,442 probably null Het
Olfr65 T A 7: 103,906,676 M79K probably damaging Het
Olfr725 G A 14: 50,034,987 R139C probably benign Het
Papd4 A T 13: 93,175,738 C180* probably null Het
Papln A G 12: 83,771,878 E78G probably null Het
Phldb3 T C 7: 24,626,722 probably null Het
Pkd1l2 A G 8: 116,997,582 I2394T probably damaging Het
Ppa2 A T 3: 133,330,439 N118I probably damaging Het
Ppef2 A T 5: 92,250,529 C43* probably null Het
Rab27a G A 9: 73,085,039 probably null Het
Rabgap1l A T 1: 160,342,113 F47I probably damaging Het
Rala A G 13: 17,893,161 I95T probably damaging Het
Rgl2 A G 17: 33,932,717 D245G probably benign Het
Rnf34 A T 5: 122,864,083 T35S probably damaging Het
Ros1 C T 10: 52,181,798 R51Q probably benign Het
Samd9l T C 6: 3,372,716 D1515G possibly damaging Het
Scn7a T C 2: 66,675,526 E1673G probably benign Het
Slc6a20a A C 9: 123,641,708 probably null Het
Tdrd5 A T 1: 156,294,500 S280T probably damaging Het
Tie1 T C 4: 118,475,603 I911V possibly damaging Het
Vipas39 G A 12: 87,251,807 R194* probably null Het
Ybx3 A C 6: 131,368,488 N307K possibly damaging Het
Ylpm1 A T 12: 85,042,125 H1216L probably damaging Het
Other mutations in Eml3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00933:Eml3 APN 19 8936398 nonsense probably null
IGL01398:Eml3 APN 19 8934234 splice site probably benign
IGL01904:Eml3 APN 19 8936766 splice site probably benign
IGL02557:Eml3 APN 19 8931381 unclassified probably benign
IGL02795:Eml3 APN 19 8933778 missense probably benign 0.43
IGL03160:Eml3 APN 19 8934955 missense probably benign 0.04
IGL03172:Eml3 APN 19 8939179 unclassified probably benign
IGL03376:Eml3 APN 19 8933790 missense probably damaging 1.00
R0063:Eml3 UTSW 19 8938478 missense probably damaging 1.00
R0063:Eml3 UTSW 19 8938478 missense probably damaging 1.00
R0097:Eml3 UTSW 19 8936651 missense probably benign 0.32
R0097:Eml3 UTSW 19 8936651 missense probably benign 0.32
R0599:Eml3 UTSW 19 8939063 missense probably benign 0.14
R0652:Eml3 UTSW 19 8933285 missense probably damaging 1.00
R0827:Eml3 UTSW 19 8938466 missense probably damaging 0.98
R0841:Eml3 UTSW 19 8937685 missense probably benign
R0880:Eml3 UTSW 19 8940915 missense possibly damaging 0.92
R0924:Eml3 UTSW 19 8933311 critical splice donor site probably null
R1127:Eml3 UTSW 19 8936308 missense probably damaging 0.99
R1156:Eml3 UTSW 19 8934130 missense probably damaging 1.00
R1160:Eml3 UTSW 19 8933250 missense probably benign 0.00
R1427:Eml3 UTSW 19 8933861 missense probably damaging 1.00
R1497:Eml3 UTSW 19 8936369 missense probably damaging 1.00
R1679:Eml3 UTSW 19 8936637 missense probably damaging 0.98
R1931:Eml3 UTSW 19 8937143 missense probably benign 0.43
R2119:Eml3 UTSW 19 8934354 critical splice donor site probably null
R4296:Eml3 UTSW 19 8931409 missense probably damaging 1.00
R5122:Eml3 UTSW 19 8937696 critical splice donor site probably null
R5288:Eml3 UTSW 19 8939274 missense probably damaging 1.00
R5467:Eml3 UTSW 19 8937582 nonsense probably null
R5836:Eml3 UTSW 19 8941295 missense possibly damaging 0.96
R5845:Eml3 UTSW 19 8939218 missense probably damaging 1.00
R5879:Eml3 UTSW 19 8935015 missense possibly damaging 0.77
R6011:Eml3 UTSW 19 8939107 missense probably damaging 1.00
R6247:Eml3 UTSW 19 8930949 missense probably benign
R6777:Eml3 UTSW 19 8936722 missense probably benign
R7132:Eml3 UTSW 19 8941028 missense probably benign 0.25
R7169:Eml3 UTSW 19 8933464 missense probably damaging 1.00
X0025:Eml3 UTSW 19 8937439 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GGAACAAAGACCCTCTGTCCAG -3'
(R):5'- ATTCACAGGATTCCTTGTCCAC -3'

Sequencing Primer
(F):5'- AAAGACCCTCTGTCCAGTCCTG -3'
(R):5'- GGATTCCTTGTCCACCCCCAC -3'
Posted On2017-02-10