Incidental Mutation 'R5882:Trp53bp2'
ID454455
Institutional Source Beutler Lab
Gene Symbol Trp53bp2
Ensembl Gene ENSMUSG00000026510
Gene Nametransformation related protein 53 binding protein 2
Synonyms53BP2, ASPP2
MMRRC Submission 043236-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5882 (G1)
Quality Score157
Status Not validated
Chromosome1
Chromosomal Location182409172-182462432 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 182442212 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 304 (V304A)
Ref Sequence ENSEMBL: ENSMUSP00000112508 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000117245]
Predicted Effect possibly damaging
Transcript: ENSMUST00000117245
AA Change: V304A

PolyPhen 2 Score 0.869 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000112508
Gene: ENSMUSG00000026510
AA Change: V304A

DomainStartEndE-ValueType
PDB:2UWQ|A 4 89 1e-53 PDB
Blast:RA 10 91 7e-50 BLAST
coiled coil region 129 306 N/A INTRINSIC
low complexity region 401 412 N/A INTRINSIC
low complexity region 495 512 N/A INTRINSIC
PDB:4IRV|H 728 788 5e-25 PDB
low complexity region 865 890 N/A INTRINSIC
ANK 964 993 2.52e-6 SMART
ANK 997 1026 7.13e-6 SMART
SH3 1066 1124 6.2e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000191626
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191804
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 96.5%
  • 20x: 86.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ASPP (apoptosis-stimulating protein of p53) family of p53 interacting proteins. The protein contains four ankyrin repeats and an SH3 domain involved in protein-protein interactions. It is localized to the perinuclear region of the cytoplasm, and regulates apoptosis and cell growth through interactions with other regulatory molecules including members of the p53 family. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation is lethal by 30 days of age, although majority die embryonically. Heterozygotes show increased susceptibility to spontaneous and induced tumors of the lymphoma and sarcoma types [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apol7e T A 15: 77,718,247 H348Q probably benign Het
Cacna1g T A 11: 94,459,819 E400V probably damaging Het
Cyp2j6 T A 4: 96,535,602 K176N probably benign Het
Dcaf4 T C 12: 83,539,429 V377A probably damaging Het
Dennd1a A G 2: 37,961,663 L71P probably damaging Het
Dmbx1 G T 4: 115,920,301 R117S probably damaging Het
Ep400 A G 5: 110,755,587 V382A probably benign Het
Kars G A 8: 112,003,425 R107* probably null Het
Kif16b C T 2: 142,707,258 probably null Het
Lrrc69 A G 4: 14,708,690 F218S probably damaging Het
Myo15b A G 11: 115,869,596 Y1158C probably damaging Het
Myom1 G C 17: 71,110,722 A1307P probably damaging Het
Nacad C T 11: 6,598,568 V1389I possibly damaging Het
Nit2 T C 16: 57,159,466 D132G probably benign Het
Nln G T 13: 104,059,498 D60E probably benign Het
Oas1f G A 5: 120,848,253 E90K probably damaging Het
Obox3 A G 7: 15,626,968 V82A probably benign Het
Olfr1277 A T 2: 111,270,139 V76E probably damaging Het
Olfr874 C T 9: 37,746,632 T166I probably benign Het
Pcdhb1 A T 18: 37,267,177 Q727L probably benign Het
Phactr1 G T 13: 42,709,851 probably null Het
Prkg1 A T 19: 31,585,697 N116K probably damaging Het
Scnn1g A T 7: 121,767,358 S593C possibly damaging Het
Serpina6 T C 12: 103,654,235 N85S probably benign Het
Spock3 A G 8: 63,143,931 T93A probably benign Het
St7 T C 6: 17,846,249 L121P probably damaging Het
Stoml2 G C 4: 43,031,003 R57G probably damaging Het
Tdrd1 C T 19: 56,848,939 R532C probably damaging Het
Tmc5 A G 7: 118,654,919 N660S probably damaging Het
Tmem38a A G 8: 72,585,887 H233R probably damaging Het
Ush1g C A 11: 115,318,542 M275I probably damaging Het
Zfp882 A T 8: 71,913,459 probably null Het
Zim1 A T 7: 6,682,738 probably null Het
Other mutations in Trp53bp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00672:Trp53bp2 APN 1 182440976 missense probably benign 0.17
IGL00920:Trp53bp2 APN 1 182444654 unclassified probably benign
IGL01336:Trp53bp2 APN 1 182431583 missense probably damaging 1.00
IGL01760:Trp53bp2 APN 1 182448428 missense possibly damaging 0.68
IGL02539:Trp53bp2 APN 1 182448691 missense probably damaging 0.99
IGL02609:Trp53bp2 APN 1 182453724 missense probably benign 0.21
IGL02720:Trp53bp2 APN 1 182453724 missense probably benign 0.21
IGL02962:Trp53bp2 APN 1 182431595 missense probably benign 0.00
IGL03348:Trp53bp2 APN 1 182453748 missense probably damaging 1.00
Nosa UTSW 1 182455740 missense probably damaging 1.00
R0012:Trp53bp2 UTSW 1 182444718 missense probably damaging 0.99
R0012:Trp53bp2 UTSW 1 182444718 missense probably damaging 0.99
R0347:Trp53bp2 UTSW 1 182441648 missense probably benign 0.08
R1422:Trp53bp2 UTSW 1 182446464 missense probably benign
R1833:Trp53bp2 UTSW 1 182429016 missense probably damaging 0.98
R1845:Trp53bp2 UTSW 1 182458903 missense probably damaging 1.00
R1893:Trp53bp2 UTSW 1 182431628 missense probably benign 0.01
R1927:Trp53bp2 UTSW 1 182452664 missense probably damaging 0.98
R2017:Trp53bp2 UTSW 1 182449015 missense probably benign
R2020:Trp53bp2 UTSW 1 182442819 missense probably damaging 1.00
R2072:Trp53bp2 UTSW 1 182458867 missense probably benign 0.00
R2120:Trp53bp2 UTSW 1 182441639 missense probably benign 0.06
R2504:Trp53bp2 UTSW 1 182441639 missense probably benign 0.26
R2970:Trp53bp2 UTSW 1 182431598 missense probably damaging 1.00
R3051:Trp53bp2 UTSW 1 182453782 missense probably damaging 0.96
R3052:Trp53bp2 UTSW 1 182453782 missense probably damaging 0.96
R3053:Trp53bp2 UTSW 1 182453782 missense probably damaging 0.96
R3151:Trp53bp2 UTSW 1 182428960 missense probably damaging 1.00
R4043:Trp53bp2 UTSW 1 182449061 missense possibly damaging 0.93
R4757:Trp53bp2 UTSW 1 182458774 missense probably benign 0.04
R4785:Trp53bp2 UTSW 1 182448997 missense probably benign
R4817:Trp53bp2 UTSW 1 182441805 critical splice donor site probably null
R4836:Trp53bp2 UTSW 1 182431582 missense probably damaging 1.00
R5040:Trp53bp2 UTSW 1 182444706 missense probably damaging 1.00
R6007:Trp53bp2 UTSW 1 182455740 missense probably damaging 1.00
R6356:Trp53bp2 UTSW 1 182448997 missense probably benign
R6886:Trp53bp2 UTSW 1 182429043 critical splice donor site probably null
R6987:Trp53bp2 UTSW 1 182446635 missense probably damaging 0.99
R7026:Trp53bp2 UTSW 1 182442735 missense probably benign
R7141:Trp53bp2 UTSW 1 182448508 missense
R7363:Trp53bp2 UTSW 1 182444666 missense probably damaging 0.99
R7452:Trp53bp2 UTSW 1 182446568 nonsense probably null
R7816:Trp53bp2 UTSW 1 182448695 missense probably damaging 0.99
R7838:Trp53bp2 UTSW 1 182455819 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTGGCACCGATGTCATTAAG -3'
(R):5'- AGCACAGCTGGATGGATTC -3'

Sequencing Primer
(F):5'- GGCACCGATGTCATTAAGTTTAAACC -3'
(R):5'- GATTCTGAGGATGCAGCTTCCC -3'
Posted On2017-02-10