Incidental Mutation 'R5882:Tmem38a'
ID454473
Institutional Source Beutler Lab
Gene Symbol Tmem38a
Ensembl Gene ENSMUSG00000031791
Gene Nametransmembrane protein 38A
Synonyms1110001E17Rik, TRIC-A
MMRRC Submission 043236-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5882 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location72572055-72587282 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 72585887 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 233 (H233R)
Ref Sequence ENSEMBL: ENSMUSP00000034244 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034244] [ENSMUST00000211914] [ENSMUST00000212763]
Predicted Effect probably damaging
Transcript: ENSMUST00000034244
AA Change: H233R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000034244
Gene: ENSMUSG00000031791
AA Change: H233R

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
Pfam:TRIC 40 231 5.5e-84 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000211914
Predicted Effect probably benign
Transcript: ENSMUST00000212763
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 96.5%
  • 20x: 86.5%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele are viable and fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apol7e T A 15: 77,718,247 H348Q probably benign Het
Cacna1g T A 11: 94,459,819 E400V probably damaging Het
Cyp2j6 T A 4: 96,535,602 K176N probably benign Het
Dcaf4 T C 12: 83,539,429 V377A probably damaging Het
Dennd1a A G 2: 37,961,663 L71P probably damaging Het
Dmbx1 G T 4: 115,920,301 R117S probably damaging Het
Ep400 A G 5: 110,755,587 V382A probably benign Het
Kars G A 8: 112,003,425 R107* probably null Het
Kif16b C T 2: 142,707,258 probably null Het
Lrrc69 A G 4: 14,708,690 F218S probably damaging Het
Myo15b A G 11: 115,869,596 Y1158C probably damaging Het
Myom1 G C 17: 71,110,722 A1307P probably damaging Het
Nacad C T 11: 6,598,568 V1389I possibly damaging Het
Nit2 T C 16: 57,159,466 D132G probably benign Het
Nln G T 13: 104,059,498 D60E probably benign Het
Oas1f G A 5: 120,848,253 E90K probably damaging Het
Obox3 A G 7: 15,626,968 V82A probably benign Het
Olfr1277 A T 2: 111,270,139 V76E probably damaging Het
Olfr874 C T 9: 37,746,632 T166I probably benign Het
Pcdhb1 A T 18: 37,267,177 Q727L probably benign Het
Phactr1 G T 13: 42,709,851 probably null Het
Prkg1 A T 19: 31,585,697 N116K probably damaging Het
Scnn1g A T 7: 121,767,358 S593C possibly damaging Het
Serpina6 T C 12: 103,654,235 N85S probably benign Het
Spock3 A G 8: 63,143,931 T93A probably benign Het
St7 T C 6: 17,846,249 L121P probably damaging Het
Stoml2 G C 4: 43,031,003 R57G probably damaging Het
Tdrd1 C T 19: 56,848,939 R532C probably damaging Het
Tmc5 A G 7: 118,654,919 N660S probably damaging Het
Trp53bp2 T C 1: 182,442,212 V304A possibly damaging Het
Ush1g C A 11: 115,318,542 M275I probably damaging Het
Zfp882 A T 8: 71,913,459 probably null Het
Zim1 A T 7: 6,682,738 probably null Het
Other mutations in Tmem38a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02572:Tmem38a APN 8 72579974 missense probably damaging 0.99
IGL02715:Tmem38a APN 8 72579668 missense possibly damaging 0.69
IGL02967:Tmem38a APN 8 72586082 missense possibly damaging 0.95
R0631:Tmem38a UTSW 8 72580018 missense probably benign 0.05
R1073:Tmem38a UTSW 8 72580103 missense probably damaging 1.00
R1161:Tmem38a UTSW 8 72579970 missense probably damaging 1.00
R1310:Tmem38a UTSW 8 72579970 missense probably damaging 1.00
R1489:Tmem38a UTSW 8 72579635 missense probably damaging 1.00
R2040:Tmem38a UTSW 8 72581252 missense probably damaging 1.00
R4508:Tmem38a UTSW 8 72572161 missense possibly damaging 0.91
R4515:Tmem38a UTSW 8 72572161 missense possibly damaging 0.91
R4517:Tmem38a UTSW 8 72572161 missense possibly damaging 0.91
R4521:Tmem38a UTSW 8 72572161 missense possibly damaging 0.91
R4522:Tmem38a UTSW 8 72572161 missense possibly damaging 0.91
R4529:Tmem38a UTSW 8 72572161 missense possibly damaging 0.91
R4867:Tmem38a UTSW 8 72581233 missense possibly damaging 0.80
R5200:Tmem38a UTSW 8 72580034 missense probably damaging 1.00
R5807:Tmem38a UTSW 8 72580100 missense probably damaging 1.00
R7803:Tmem38a UTSW 8 72572120 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGGAAGTCATGCCTCTTCAGAG -3'
(R):5'- TCCTTCTACCAAGCACGCAG -3'

Sequencing Primer
(F):5'- GAAGTCATGCCTCTTCAGAGTCCAG -3'
(R):5'- AGTGGATTCCTGGGGCCAAC -3'
Posted On2017-02-10