Incidental Mutation 'R5882:Dcaf4'
ID454483
Institutional Source Beutler Lab
Gene Symbol Dcaf4
Ensembl Gene ENSMUSG00000021222
Gene NameDDB1 and CUL4 associated factor 4
Synonyms1110018E21Rik, Wdr21
MMRRC Submission 043236-MU
Accession Numbers

Genbank: NM_030246; MGI: 1921078

Is this an essential gene? Probably non essential (E-score: 0.078) question?
Stock #R5882 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location83520466-83541920 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 83539429 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 377 (V377A)
Ref Sequence ENSEMBL: ENSMUSP00000021645 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021645] [ENSMUST00000223291]
Predicted Effect probably damaging
Transcript: ENSMUST00000021645
AA Change: V377A

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000021645
Gene: ENSMUSG00000021222
AA Change: V377A

DomainStartEndE-ValueType
low complexity region 8 16 N/A INTRINSIC
low complexity region 48 61 N/A INTRINSIC
Blast:WD40 274 313 2e-14 BLAST
WD40 361 399 8.36e-2 SMART
WD40 402 443 7.4e0 SMART
Blast:WD40 446 494 1e-15 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221944
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222607
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222725
Predicted Effect possibly damaging
Transcript: ENSMUST00000223291
AA Change: V390A

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 96.5%
  • 20x: 86.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a WD repeat-containing protein that interacts with the Cul4-Ddb1 E3 ligase macromolecular complex. Multiple alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jul 2009]
Allele List at MGI

All alleles(39) : Gene trapped(39)

Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apol7e T A 15: 77,718,247 H348Q probably benign Het
Cacna1g T A 11: 94,459,819 E400V probably damaging Het
Cyp2j6 T A 4: 96,535,602 K176N probably benign Het
Dennd1a A G 2: 37,961,663 L71P probably damaging Het
Dmbx1 G T 4: 115,920,301 R117S probably damaging Het
Ep400 A G 5: 110,755,587 V382A probably benign Het
Kars G A 8: 112,003,425 R107* probably null Het
Kif16b C T 2: 142,707,258 probably null Het
Lrrc69 A G 4: 14,708,690 F218S probably damaging Het
Myo15b A G 11: 115,869,596 Y1158C probably damaging Het
Myom1 G C 17: 71,110,722 A1307P probably damaging Het
Nacad C T 11: 6,598,568 V1389I possibly damaging Het
Nit2 T C 16: 57,159,466 D132G probably benign Het
Nln G T 13: 104,059,498 D60E probably benign Het
Oas1f G A 5: 120,848,253 E90K probably damaging Het
Obox3 A G 7: 15,626,968 V82A probably benign Het
Olfr1277 A T 2: 111,270,139 V76E probably damaging Het
Olfr874 C T 9: 37,746,632 T166I probably benign Het
Pcdhb1 A T 18: 37,267,177 Q727L probably benign Het
Phactr1 G T 13: 42,709,851 probably null Het
Prkg1 A T 19: 31,585,697 N116K probably damaging Het
Scnn1g A T 7: 121,767,358 S593C possibly damaging Het
Serpina6 T C 12: 103,654,235 N85S probably benign Het
Spock3 A G 8: 63,143,931 T93A probably benign Het
St7 T C 6: 17,846,249 L121P probably damaging Het
Stoml2 G C 4: 43,031,003 R57G probably damaging Het
Tdrd1 C T 19: 56,848,939 R532C probably damaging Het
Tmc5 A G 7: 118,654,919 N660S probably damaging Het
Tmem38a A G 8: 72,585,887 H233R probably damaging Het
Trp53bp2 T C 1: 182,442,212 V304A possibly damaging Het
Ush1g C A 11: 115,318,542 M275I probably damaging Het
Zfp882 A T 8: 71,913,459 probably null Het
Zim1 A T 7: 6,682,738 probably null Het
Other mutations in Dcaf4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00763:Dcaf4 APN 12 83539333 missense probably damaging 1.00
IGL01401:Dcaf4 APN 12 83541374 missense probably damaging 1.00
IGL02393:Dcaf4 APN 12 83530031 missense probably damaging 1.00
IGL02970:Dcaf4 APN 12 83529215 missense probably damaging 0.99
F5770:Dcaf4 UTSW 12 83537701 splice site probably null
PIT4504001:Dcaf4 UTSW 12 83534011 critical splice donor site probably null
R0032:Dcaf4 UTSW 12 83535988 splice site probably benign
R0032:Dcaf4 UTSW 12 83535988 splice site probably benign
R0164:Dcaf4 UTSW 12 83535988 splice site probably benign
R0165:Dcaf4 UTSW 12 83535988 splice site probably benign
R0167:Dcaf4 UTSW 12 83535988 splice site probably benign
R0211:Dcaf4 UTSW 12 83535961 missense probably damaging 1.00
R0211:Dcaf4 UTSW 12 83535961 missense probably damaging 1.00
R0594:Dcaf4 UTSW 12 83538043 critical splice donor site probably null
R1191:Dcaf4 UTSW 12 83535967 missense probably damaging 1.00
R4499:Dcaf4 UTSW 12 83539360 missense probably damaging 1.00
R4896:Dcaf4 UTSW 12 83539459 missense possibly damaging 0.86
R4932:Dcaf4 UTSW 12 83532304 missense possibly damaging 0.61
R7084:Dcaf4 UTSW 12 83537797 frame shift probably null
R7564:Dcaf4 UTSW 12 83541523 missense probably damaging 0.97
R7777:Dcaf4 UTSW 12 83537959 missense probably damaging 0.97
V7583:Dcaf4 UTSW 12 83537701 splice site probably null
Predicted Primers PCR Primer
(F):5'- CATATCCTTTCTGCCAGGTGG -3'
(R):5'- GTGAGCCTTGTGTCCATCAG -3'

Sequencing Primer
(F):5'- CCTTTCTGCCAGGTGGTAAAAACTG -3'
(R):5'- GAGCCTTGTGTCCATCAGAATCATAG -3'
Posted On2017-02-10