Incidental Mutation 'R0555:Svep1'
ID 45451
Institutional Source Beutler Lab
Gene Symbol Svep1
Ensembl Gene ENSMUSG00000028369
Gene Name sushi, von Willebrand factor type A, EGF and pentraxin domain containing 1
Synonyms 1110021D17Rik, Polydom, D430029O09Rik, 4833413O10Rik
MMRRC Submission 038747-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R0555 (G1)
Quality Score 225
Status Validated
Chromosome 4
Chromosomal Location 58042796-58206596 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 58128858 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 613 (Y613F)
Ref Sequence ENSEMBL: ENSMUSP00000045856 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042850]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000042850
AA Change: Y613F

PolyPhen 2 Score 0.707 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000045856
Gene: ENSMUSG00000028369
AA Change: Y613F

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
low complexity region 51 60 N/A INTRINSIC
VWA 82 261 2.18e-32 SMART
Pfam:GCC2_GCC3 311 361 3.4e-14 PFAM
CCP 379 434 3.62e-8 SMART
CCP 439 494 1.78e-16 SMART
CCP 499 559 2.13e-5 SMART
Pfam:HYR 560 642 1.7e-20 PFAM
Pfam:HYR 643 722 4.6e-15 PFAM
CCP 727 787 3.59e-1 SMART
low complexity region 862 873 N/A INTRINSIC
Pfam:GCC2_GCC3 1004 1051 3.2e-16 PFAM
Pfam:GCC2_GCC3 1058 1105 5.4e-19 PFAM
Pfam:GCC2_GCC3 1112 1159 7.7e-19 PFAM
EGF 1195 1228 3.12e-7 SMART
EGF_CA 1230 1266 3.93e-13 SMART
EGF_CA 1268 1304 8.3e-12 SMART
EGF_CA 1306 1342 4.59e-14 SMART
EGF_CA 1344 1380 8.69e-15 SMART
EGF_CA 1382 1418 3.42e-13 SMART
Pfam:Pentaxin 1429 1622 1.8e-28 PFAM
Pfam:Laminin_G_3 1432 1589 1.1e-20 PFAM
CCP 1630 1684 1.71e-9 SMART
CCP 1689 1742 2.31e-15 SMART
EGF_CA 1744 1783 5.23e-9 SMART
CCP 1788 1841 4.62e-15 SMART
CCP 1846 1899 8.29e-17 SMART
CCP 1904 1957 1.1e-12 SMART
CCP 1962 2015 5.6e-14 SMART
CCP 2020 2077 4.15e-8 SMART
CCP 2082 2140 8.11e-11 SMART
CCP 2145 2198 4.38e-16 SMART
CCP 2203 2258 1.69e-8 SMART
CCP 2263 2317 1.42e-15 SMART
CCP 2322 2375 3.1e-7 SMART
CCP 2380 2434 4.55e-14 SMART
CCP 2439 2492 6.95e-10 SMART
CCP 2497 2550 8.88e-17 SMART
CCP 2555 2607 1.7e-13 SMART
CCP 2651 2709 1.02e-7 SMART
CCP 2714 2767 9.6e-13 SMART
CCP 2772 2825 3.64e-13 SMART
CCP 2830 2883 6.63e-16 SMART
CCP 2888 2941 2.76e-13 SMART
CCP 2946 2999 4.41e-12 SMART
CCP 3004 3055 4.25e-5 SMART
CCP 3060 3113 5.15e-13 SMART
CCP 3118 3172 2.11e-9 SMART
CCP 3177 3232 1.02e-7 SMART
CCP 3237 3290 6.19e-16 SMART
CCP 3295 3348 5.35e-11 SMART
CCP 3353 3407 8.43e-9 SMART
CCP 3412 3464 2.44e-14 SMART
EGF 3467 3496 1.28e-3 SMART
EGF 3499 3528 1.15e-5 SMART
EGF 3531 3560 2.85e-1 SMART
Meta Mutation Damage Score 0.1845 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.8%
  • 10x: 96.9%
  • 20x: 93.8%
Validation Efficiency 100% (98/98)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit complete preweaning lethality, edema, abnormal skin coloration, thick epidermis, acanthosis, and tail/limb abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 96 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam10 T A 9: 70,661,516 (GRCm39) I363N probably damaging Het
Ahcyl2 T C 6: 29,890,670 (GRCm39) probably benign Het
Asap1 A G 15: 63,966,213 (GRCm39) L941P probably damaging Het
Aurka G A 2: 172,209,067 (GRCm39) R23C probably benign Het
Cacna1c C T 6: 118,589,586 (GRCm39) R1446H probably damaging Het
Casp8ap2 T A 4: 32,640,381 (GRCm39) H478Q probably damaging Het
Clcn4 C T 7: 7,293,503 (GRCm39) A418T possibly damaging Het
Cplx3 T C 9: 57,521,384 (GRCm39) T193A probably benign Het
Cpxm2 A T 7: 131,645,772 (GRCm39) Y715* probably null Het
Csmd1 T C 8: 16,235,287 (GRCm39) M1179V probably benign Het
Ddx21 A T 10: 62,423,307 (GRCm39) F632I probably damaging Het
Dnai1 C A 4: 41,625,335 (GRCm39) T433K possibly damaging Het
Dpyd G A 3: 119,225,191 (GRCm39) G988D probably damaging Het
Dync1i2 AAAAGAAGAGGAAAGAAGAGGAAAG AAAAGAAGAGGAAAG 2: 71,044,862 (GRCm39) probably null Het
Dync1li2 A T 8: 105,147,297 (GRCm39) S466T probably benign Het
Ears2 T C 7: 121,647,667 (GRCm39) T206A probably benign Het
Elmod1 A T 9: 53,838,876 (GRCm39) probably benign Het
Eps8l3 C A 3: 107,799,661 (GRCm39) D590E probably benign Het
Etfdh A T 3: 79,513,112 (GRCm39) H370Q probably benign Het
Fam83g C A 11: 61,598,489 (GRCm39) A792E probably benign Het
Ffar3 G T 7: 30,554,962 (GRCm39) Y119* probably null Het
Fosb G T 7: 19,041,138 (GRCm39) S118R possibly damaging Het
Foxn4 G A 5: 114,401,175 (GRCm39) L3F probably damaging Het
Foxo4 A G X: 100,298,784 (GRCm39) K65E probably damaging Het
Frem2 A G 3: 53,424,281 (GRCm39) L3052P probably damaging Het
Fubp3 G A 2: 31,498,149 (GRCm39) R101H probably damaging Het
Gba2 C A 4: 43,569,927 (GRCm39) G429C probably damaging Het
Gimap1 T C 6: 48,718,363 (GRCm39) probably benign Het
Gnas A G 2: 174,140,304 (GRCm39) T158A possibly damaging Het
Gpc5 T C 14: 115,789,740 (GRCm39) V538A probably damaging Het
Greb1l T C 18: 10,458,781 (GRCm39) probably benign Het
H2-M10.5 G A 17: 37,085,620 (GRCm39) G260R probably damaging Het
Hbs1l A C 10: 21,225,222 (GRCm39) Q412H probably benign Het
Hecw1 G T 13: 14,411,526 (GRCm39) T1058N probably damaging Het
Heph A T X: 95,601,690 (GRCm39) T1027S probably damaging Het
Hoga1 A C 19: 42,034,514 (GRCm39) E53A possibly damaging Het
Insrr T G 3: 87,721,744 (GRCm39) probably benign Het
Ipo11 A T 13: 107,028,969 (GRCm39) V328D probably damaging Het
Jakmip1 T C 5: 37,276,217 (GRCm39) V509A probably damaging Het
Jmjd1c T C 10: 67,061,568 (GRCm39) V1307A probably benign Het
Kmt2a T A 9: 44,758,868 (GRCm39) S1027C probably damaging Het
Kprp G C 3: 92,731,664 (GRCm39) P462R unknown Het
Lrit3 A T 3: 129,584,945 (GRCm39) V271D probably damaging Het
Map4 T A 9: 109,808,171 (GRCm39) probably benign Het
Mark4 A C 7: 19,182,598 (GRCm39) probably benign Het
Mfsd14b A G 13: 65,226,259 (GRCm39) V142A probably benign Het
Mis18bp1 A T 12: 65,208,227 (GRCm39) I162N possibly damaging Het
Mrpl43 A T 19: 44,994,391 (GRCm39) probably benign Het
Mrpl47 A G 3: 32,790,842 (GRCm39) F16S probably benign Het
Myh2 G T 11: 67,069,793 (GRCm39) G380C probably damaging Het
Myo15a T C 11: 60,412,464 (GRCm39) Y3284H probably damaging Het
Nectin2 A G 7: 19,467,148 (GRCm39) probably benign Het
Neu3 A G 7: 99,463,390 (GRCm39) V111A probably damaging Het
Nol4l T C 2: 153,259,604 (GRCm39) probably null Het
Nphp3 C A 9: 103,900,633 (GRCm39) H510Q probably damaging Het
Nprl3 T A 11: 32,183,118 (GRCm39) probably null Het
Or14c39 A G 7: 86,344,516 (GRCm39) N284S probably damaging Het
Or4c58 T C 2: 89,674,787 (GRCm39) T177A probably benign Het
Or52ab7 T C 7: 102,978,170 (GRCm39) V159A probably benign Het
Or6c2 T C 10: 129,362,765 (GRCm39) I223T possibly damaging Het
Pex1 A G 5: 3,656,130 (GRCm39) E319G possibly damaging Het
Pgap6 T C 17: 26,336,088 (GRCm39) L130S probably benign Het
Phtf1 C A 3: 103,911,785 (GRCm39) T709K probably damaging Het
Plek2 A T 12: 78,938,946 (GRCm39) L271Q probably damaging Het
Plekhg5 T A 4: 152,191,926 (GRCm39) C421* probably null Het
Polk A C 13: 96,620,687 (GRCm39) C525W probably damaging Het
Ppfibp2 T C 7: 107,328,381 (GRCm39) S471P probably damaging Het
Prickle2 A T 6: 92,435,546 (GRCm39) F74L probably benign Het
Prl7d1 A T 13: 27,896,038 (GRCm39) V113D probably benign Het
Prr14 C T 7: 127,071,267 (GRCm39) probably benign Het
Ptpro T A 6: 137,420,592 (GRCm39) V1007D probably damaging Het
Ret A G 6: 118,155,571 (GRCm39) V375A probably damaging Het
Rora T C 9: 69,269,028 (GRCm39) F41S probably damaging Het
Sall1 T C 8: 89,758,386 (GRCm39) T573A probably benign Het
Shb A G 4: 45,458,321 (GRCm39) V281A possibly damaging Het
Slc25a26 A T 6: 94,569,391 (GRCm39) probably null Het
Sltm T C 9: 70,493,363 (GRCm39) F769L probably damaging Het
Snx9 T A 17: 5,968,688 (GRCm39) M328K probably damaging Het
Stk25 G T 1: 93,552,313 (GRCm39) Q356K probably benign Het
Syne4 G A 7: 30,016,169 (GRCm39) A195T probably damaging Het
Tmem217b A T 17: 29,738,545 (GRCm39) F74I probably benign Het
Trcg1 C T 9: 57,149,616 (GRCm39) T396M probably damaging Het
Trim30b A G 7: 104,006,505 (GRCm39) V117A possibly damaging Het
Trpc4 T C 3: 54,209,511 (GRCm39) probably benign Het
Ttll4 A G 1: 74,727,439 (GRCm39) H827R probably damaging Het
Tut7 A G 13: 59,948,131 (GRCm39) V328A probably benign Het
Urgcp T C 11: 5,667,477 (GRCm39) E287G probably damaging Het
Usp2 G T 9: 44,004,081 (GRCm39) L319F probably damaging Het
Vmn1r167 A T 7: 23,204,512 (GRCm39) V168D probably damaging Het
Vmn2r100 C A 17: 19,742,382 (GRCm39) P252Q possibly damaging Het
Vmn2r61 A T 7: 41,915,442 (GRCm39) I130F probably benign Het
Vmn2r63 A T 7: 42,577,952 (GRCm39) Y195* probably null Het
Vmn2r81 T C 10: 79,129,283 (GRCm39) S725P probably damaging Het
Wnt10b A G 15: 98,670,818 (GRCm39) probably benign Het
Zfp292 T C 4: 34,807,194 (GRCm39) E1950G probably damaging Het
Zfyve16 A G 13: 92,653,028 (GRCm39) probably benign Het
Other mutations in Svep1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00475:Svep1 APN 4 58,176,077 (GRCm39) missense probably damaging 0.98
IGL00489:Svep1 APN 4 58,068,988 (GRCm39) missense possibly damaging 0.71
IGL00496:Svep1 APN 4 58,069,001 (GRCm39) missense possibly damaging 0.95
IGL00864:Svep1 APN 4 58,068,533 (GRCm39) nonsense probably null
IGL00904:Svep1 APN 4 58,097,398 (GRCm39) missense probably benign 0.00
IGL00935:Svep1 APN 4 58,090,664 (GRCm39) missense possibly damaging 0.71
IGL00963:Svep1 APN 4 58,072,791 (GRCm39) nonsense probably null
IGL01077:Svep1 APN 4 58,068,760 (GRCm39) missense possibly damaging 0.71
IGL01084:Svep1 APN 4 58,111,419 (GRCm39) missense possibly damaging 0.71
IGL01150:Svep1 APN 4 58,070,302 (GRCm39) missense probably benign 0.04
IGL01161:Svep1 APN 4 58,146,569 (GRCm39) missense probably damaging 0.96
IGL01360:Svep1 APN 4 58,116,554 (GRCm39) missense possibly damaging 0.73
IGL01365:Svep1 APN 4 58,100,878 (GRCm39) critical splice acceptor site probably null
IGL01396:Svep1 APN 4 58,068,552 (GRCm39) missense possibly damaging 0.85
IGL01601:Svep1 APN 4 58,084,872 (GRCm39) missense probably damaging 1.00
IGL01636:Svep1 APN 4 58,116,622 (GRCm39) missense possibly damaging 0.96
IGL01838:Svep1 APN 4 58,121,910 (GRCm39) missense possibly damaging 0.72
IGL01949:Svep1 APN 4 58,176,006 (GRCm39) missense probably damaging 1.00
IGL01984:Svep1 APN 4 58,068,877 (GRCm39) missense possibly damaging 0.93
IGL02005:Svep1 APN 4 58,069,056 (GRCm39) missense possibly damaging 0.93
IGL02036:Svep1 APN 4 58,088,245 (GRCm39) missense possibly damaging 0.85
IGL02039:Svep1 APN 4 58,123,980 (GRCm39) critical splice donor site probably null
IGL02043:Svep1 APN 4 58,068,556 (GRCm39) missense probably benign 0.19
IGL02073:Svep1 APN 4 58,070,104 (GRCm39) missense probably benign 0.06
IGL02188:Svep1 APN 4 58,068,382 (GRCm39) missense possibly damaging 0.71
IGL02256:Svep1 APN 4 58,070,311 (GRCm39) missense possibly damaging 0.71
IGL02284:Svep1 APN 4 58,072,819 (GRCm39) missense probably benign 0.32
IGL02323:Svep1 APN 4 58,070,236 (GRCm39) nonsense probably null
IGL02440:Svep1 APN 4 58,145,293 (GRCm39) missense probably benign 0.06
IGL02449:Svep1 APN 4 58,070,296 (GRCm39) missense possibly damaging 0.71
IGL02501:Svep1 APN 4 58,145,341 (GRCm39) splice site probably benign
IGL02568:Svep1 APN 4 58,135,441 (GRCm39) missense probably benign 0.42
IGL02625:Svep1 APN 4 58,115,807 (GRCm39) missense possibly damaging 0.53
IGL02795:Svep1 APN 4 58,123,223 (GRCm39) missense probably damaging 1.00
IGL02818:Svep1 APN 4 58,069,804 (GRCm39) missense possibly damaging 0.71
IGL02871:Svep1 APN 4 58,100,871 (GRCm39) missense probably benign
IGL02875:Svep1 APN 4 58,082,821 (GRCm39) splice site probably benign
IGL02887:Svep1 APN 4 58,145,301 (GRCm39) missense probably damaging 1.00
IGL03240:Svep1 APN 4 58,048,188 (GRCm39) missense possibly damaging 0.73
IGL03243:Svep1 APN 4 58,133,387 (GRCm39) missense probably benign 0.06
IGL03264:Svep1 APN 4 58,066,422 (GRCm39) splice site probably benign
IGL03288:Svep1 APN 4 58,116,532 (GRCm39) missense probably benign 0.01
IGL03340:Svep1 APN 4 58,111,451 (GRCm39) missense possibly damaging 0.96
IGL03341:Svep1 APN 4 58,070,308 (GRCm39) nonsense probably null
IGL03348:Svep1 APN 4 58,113,635 (GRCm39) missense probably damaging 1.00
R0001:Svep1 UTSW 4 58,066,460 (GRCm39) missense possibly damaging 0.93
R0042:Svep1 UTSW 4 58,123,192 (GRCm39) missense possibly damaging 0.92
R0042:Svep1 UTSW 4 58,123,192 (GRCm39) missense possibly damaging 0.92
R0125:Svep1 UTSW 4 58,099,937 (GRCm39) splice site probably benign
R0142:Svep1 UTSW 4 58,118,232 (GRCm39) missense probably benign 0.33
R0147:Svep1 UTSW 4 58,116,608 (GRCm39) missense possibly damaging 0.85
R0148:Svep1 UTSW 4 58,116,608 (GRCm39) missense possibly damaging 0.85
R0157:Svep1 UTSW 4 58,069,830 (GRCm39) missense possibly damaging 0.72
R0195:Svep1 UTSW 4 58,089,514 (GRCm39) missense possibly damaging 0.82
R0197:Svep1 UTSW 4 58,070,851 (GRCm39) missense possibly damaging 0.71
R0257:Svep1 UTSW 4 58,179,610 (GRCm39) missense possibly damaging 0.71
R0314:Svep1 UTSW 4 58,096,331 (GRCm39) missense possibly damaging 0.71
R0316:Svep1 UTSW 4 58,072,737 (GRCm39) missense probably damaging 0.98
R0322:Svep1 UTSW 4 58,057,996 (GRCm39) splice site probably benign
R0426:Svep1 UTSW 4 58,073,333 (GRCm39) missense possibly damaging 0.87
R0446:Svep1 UTSW 4 58,088,280 (GRCm39) missense probably damaging 1.00
R0457:Svep1 UTSW 4 58,118,136 (GRCm39) missense probably damaging 1.00
R0471:Svep1 UTSW 4 58,054,700 (GRCm39) missense possibly damaging 0.85
R0634:Svep1 UTSW 4 58,070,661 (GRCm39) missense possibly damaging 0.86
R0636:Svep1 UTSW 4 58,073,121 (GRCm39) nonsense probably null
R0827:Svep1 UTSW 4 58,053,113 (GRCm39) splice site probably benign
R1025:Svep1 UTSW 4 58,087,817 (GRCm39) missense possibly damaging 0.86
R1027:Svep1 UTSW 4 58,094,084 (GRCm39) missense possibly damaging 0.86
R1069:Svep1 UTSW 4 58,070,239 (GRCm39) missense probably damaging 1.00
R1161:Svep1 UTSW 4 58,069,416 (GRCm39) missense possibly damaging 0.71
R1245:Svep1 UTSW 4 58,066,427 (GRCm39) critical splice donor site probably null
R1282:Svep1 UTSW 4 58,100,032 (GRCm39) missense possibly damaging 0.93
R1310:Svep1 UTSW 4 58,069,416 (GRCm39) missense possibly damaging 0.71
R1444:Svep1 UTSW 4 58,115,754 (GRCm39) missense possibly damaging 0.53
R1460:Svep1 UTSW 4 58,068,740 (GRCm39) missense possibly damaging 0.85
R1500:Svep1 UTSW 4 58,070,239 (GRCm39) missense probably damaging 1.00
R1628:Svep1 UTSW 4 58,107,561 (GRCm39) missense probably benign 0.00
R1712:Svep1 UTSW 4 58,070,629 (GRCm39) missense probably benign 0.06
R1774:Svep1 UTSW 4 58,146,562 (GRCm39) missense possibly damaging 0.92
R1783:Svep1 UTSW 4 58,073,333 (GRCm39) missense probably benign
R1829:Svep1 UTSW 4 58,096,310 (GRCm39) missense possibly damaging 0.93
R1978:Svep1 UTSW 4 58,097,292 (GRCm39) missense possibly damaging 0.73
R1993:Svep1 UTSW 4 58,064,170 (GRCm39) critical splice donor site probably null
R2017:Svep1 UTSW 4 58,070,568 (GRCm39) missense probably benign 0.08
R2058:Svep1 UTSW 4 58,084,554 (GRCm39) missense possibly damaging 0.92
R2109:Svep1 UTSW 4 58,206,030 (GRCm39) missense possibly damaging 0.51
R2215:Svep1 UTSW 4 58,138,602 (GRCm39) splice site probably benign
R2281:Svep1 UTSW 4 58,082,677 (GRCm39) missense possibly damaging 0.85
R2504:Svep1 UTSW 4 58,135,628 (GRCm39) splice site probably null
R2763:Svep1 UTSW 4 58,084,061 (GRCm39) missense possibly damaging 0.86
R3122:Svep1 UTSW 4 58,087,845 (GRCm39) missense possibly damaging 0.51
R3605:Svep1 UTSW 4 58,066,542 (GRCm39) missense probably benign 0.32
R3763:Svep1 UTSW 4 58,084,833 (GRCm39) missense possibly damaging 0.89
R3827:Svep1 UTSW 4 58,096,177 (GRCm39) missense probably damaging 0.98
R3829:Svep1 UTSW 4 58,096,177 (GRCm39) missense probably damaging 0.98
R3830:Svep1 UTSW 4 58,096,177 (GRCm39) missense probably damaging 0.98
R3910:Svep1 UTSW 4 58,145,156 (GRCm39) critical splice donor site probably null
R3943:Svep1 UTSW 4 58,084,807 (GRCm39) splice site probably null
R3944:Svep1 UTSW 4 58,084,807 (GRCm39) splice site probably null
R4153:Svep1 UTSW 4 58,089,426 (GRCm39) missense possibly damaging 0.52
R4154:Svep1 UTSW 4 58,069,068 (GRCm39) missense possibly damaging 0.71
R4191:Svep1 UTSW 4 58,046,601 (GRCm39) missense possibly damaging 0.86
R4355:Svep1 UTSW 4 58,138,695 (GRCm39) missense possibly damaging 0.71
R4388:Svep1 UTSW 4 58,069,249 (GRCm39) missense possibly damaging 0.93
R4532:Svep1 UTSW 4 58,068,886 (GRCm39) missense possibly damaging 0.52
R4584:Svep1 UTSW 4 58,068,526 (GRCm39) nonsense probably null
R4592:Svep1 UTSW 4 58,084,028 (GRCm39) missense possibly damaging 0.93
R4593:Svep1 UTSW 4 58,091,944 (GRCm39) missense possibly damaging 0.71
R4625:Svep1 UTSW 4 58,072,698 (GRCm39) missense probably damaging 0.98
R4639:Svep1 UTSW 4 58,082,724 (GRCm39) missense probably benign
R4700:Svep1 UTSW 4 58,097,323 (GRCm39) missense possibly damaging 0.71
R4720:Svep1 UTSW 4 58,205,869 (GRCm39) missense possibly damaging 0.71
R4724:Svep1 UTSW 4 58,070,752 (GRCm39) missense possibly damaging 0.71
R4753:Svep1 UTSW 4 58,053,212 (GRCm39) missense probably benign 0.06
R4781:Svep1 UTSW 4 58,070,340 (GRCm39) missense probably damaging 0.98
R4820:Svep1 UTSW 4 58,082,664 (GRCm39) missense probably benign 0.27
R4896:Svep1 UTSW 4 58,087,751 (GRCm39) missense probably benign 0.08
R4905:Svep1 UTSW 4 58,069,308 (GRCm39) missense probably benign 0.00
R4910:Svep1 UTSW 4 58,096,276 (GRCm39) missense possibly damaging 0.71
R4972:Svep1 UTSW 4 58,087,778 (GRCm39) missense possibly damaging 0.71
R5004:Svep1 UTSW 4 58,087,751 (GRCm39) missense probably benign 0.08
R5088:Svep1 UTSW 4 58,120,648 (GRCm39) missense possibly damaging 0.73
R5112:Svep1 UTSW 4 58,068,610 (GRCm39) nonsense probably null
R5185:Svep1 UTSW 4 58,084,534 (GRCm39) missense probably damaging 0.99
R5302:Svep1 UTSW 4 58,096,183 (GRCm39) missense possibly damaging 0.71
R5307:Svep1 UTSW 4 58,072,677 (GRCm39) missense possibly damaging 0.71
R5339:Svep1 UTSW 4 58,121,892 (GRCm39) missense possibly damaging 0.96
R5379:Svep1 UTSW 4 58,072,991 (GRCm39) missense possibly damaging 0.51
R5384:Svep1 UTSW 4 58,104,545 (GRCm39) missense possibly damaging 0.71
R5414:Svep1 UTSW 4 58,206,322 (GRCm39) missense possibly damaging 0.53
R5514:Svep1 UTSW 4 58,044,054 (GRCm39) missense possibly damaging 0.53
R5538:Svep1 UTSW 4 58,049,282 (GRCm39) critical splice acceptor site probably null
R5549:Svep1 UTSW 4 58,057,954 (GRCm39) missense probably benign 0.32
R5618:Svep1 UTSW 4 58,070,537 (GRCm39) missense probably benign
R5623:Svep1 UTSW 4 58,091,964 (GRCm39) missense possibly damaging 0.92
R5686:Svep1 UTSW 4 58,072,826 (GRCm39) missense possibly damaging 0.71
R5743:Svep1 UTSW 4 58,096,223 (GRCm39) missense possibly damaging 0.71
R5773:Svep1 UTSW 4 58,099,985 (GRCm39) missense possibly damaging 0.86
R5809:Svep1 UTSW 4 58,116,524 (GRCm39) missense possibly damaging 0.73
R5896:Svep1 UTSW 4 58,084,906 (GRCm39) missense possibly damaging 0.71
R5918:Svep1 UTSW 4 58,069,345 (GRCm39) missense possibly damaging 0.71
R5969:Svep1 UTSW 4 58,070,977 (GRCm39) nonsense probably null
R6010:Svep1 UTSW 4 58,115,832 (GRCm39) missense possibly damaging 0.95
R6187:Svep1 UTSW 4 58,072,872 (GRCm39) missense probably damaging 1.00
R6192:Svep1 UTSW 4 58,104,536 (GRCm39) missense possibly damaging 0.92
R6209:Svep1 UTSW 4 58,128,869 (GRCm39) missense probably benign 0.32
R6234:Svep1 UTSW 4 58,113,458 (GRCm39) splice site probably null
R6326:Svep1 UTSW 4 58,073,045 (GRCm39) missense possibly damaging 0.51
R6400:Svep1 UTSW 4 58,049,169 (GRCm39) missense probably damaging 1.00
R6418:Svep1 UTSW 4 58,053,126 (GRCm39) missense probably benign 0.01
R6440:Svep1 UTSW 4 58,116,555 (GRCm39) missense possibly damaging 0.53
R6489:Svep1 UTSW 4 58,100,066 (GRCm39) missense probably damaging 1.00
R6515:Svep1 UTSW 4 58,088,280 (GRCm39) missense probably damaging 1.00
R6738:Svep1 UTSW 4 58,123,180 (GRCm39) missense possibly damaging 0.71
R6773:Svep1 UTSW 4 58,049,146 (GRCm39) missense possibly damaging 0.71
R6796:Svep1 UTSW 4 58,064,275 (GRCm39) missense probably benign 0.01
R7055:Svep1 UTSW 4 58,120,642 (GRCm39) missense probably benign 0.33
R7055:Svep1 UTSW 4 58,064,275 (GRCm39) missense probably benign 0.19
R7111:Svep1 UTSW 4 58,118,207 (GRCm39) missense possibly damaging 0.70
R7161:Svep1 UTSW 4 58,128,859 (GRCm39) missense possibly damaging 0.93
R7162:Svep1 UTSW 4 58,070,262 (GRCm39) missense possibly damaging 0.71
R7182:Svep1 UTSW 4 58,043,991 (GRCm39) missense probably benign 0.18
R7292:Svep1 UTSW 4 58,111,395 (GRCm39) missense possibly damaging 0.71
R7299:Svep1 UTSW 4 58,046,587 (GRCm39) nonsense probably null
R7301:Svep1 UTSW 4 58,046,587 (GRCm39) nonsense probably null
R7316:Svep1 UTSW 4 58,068,763 (GRCm39) missense possibly damaging 0.71
R7337:Svep1 UTSW 4 58,108,323 (GRCm39) missense probably damaging 0.98
R7391:Svep1 UTSW 4 58,145,185 (GRCm39) missense probably damaging 0.98
R7402:Svep1 UTSW 4 58,069,699 (GRCm39) missense possibly damaging 0.71
R7445:Svep1 UTSW 4 58,094,122 (GRCm39) missense possibly damaging 0.85
R7450:Svep1 UTSW 4 58,064,248 (GRCm39) missense possibly damaging 0.71
R7492:Svep1 UTSW 4 58,066,468 (GRCm39) missense possibly damaging 0.51
R7505:Svep1 UTSW 4 58,115,862 (GRCm39) missense possibly damaging 0.53
R7509:Svep1 UTSW 4 58,090,683 (GRCm39) missense probably benign 0.40
R7538:Svep1 UTSW 4 58,053,260 (GRCm39) missense possibly damaging 0.71
R7555:Svep1 UTSW 4 58,069,422 (GRCm39) missense probably damaging 0.98
R7660:Svep1 UTSW 4 58,087,782 (GRCm39) missense probably benign 0.32
R7670:Svep1 UTSW 4 58,097,424 (GRCm39) missense probably damaging 1.00
R7719:Svep1 UTSW 4 58,068,523 (GRCm39) missense probably damaging 0.97
R7733:Svep1 UTSW 4 58,049,239 (GRCm39) missense probably benign 0.03
R7781:Svep1 UTSW 4 58,069,251 (GRCm39) missense possibly damaging 0.71
R7821:Svep1 UTSW 4 58,179,601 (GRCm39) missense probably damaging 0.99
R7832:Svep1 UTSW 4 58,054,539 (GRCm39) missense probably benign 0.44
R8017:Svep1 UTSW 4 58,146,637 (GRCm39) missense probably damaging 0.99
R8019:Svep1 UTSW 4 58,146,637 (GRCm39) missense probably damaging 0.99
R8066:Svep1 UTSW 4 58,113,650 (GRCm39) missense probably benign 0.33
R8159:Svep1 UTSW 4 58,087,815 (GRCm39) missense probably benign 0.01
R8159:Svep1 UTSW 4 58,069,396 (GRCm39) missense possibly damaging 0.71
R8170:Svep1 UTSW 4 58,069,378 (GRCm39) missense probably benign 0.00
R8246:Svep1 UTSW 4 58,091,889 (GRCm39) missense probably damaging 0.96
R8392:Svep1 UTSW 4 58,070,566 (GRCm39) missense possibly damaging 0.71
R8436:Svep1 UTSW 4 58,044,053 (GRCm39) missense possibly damaging 0.86
R8544:Svep1 UTSW 4 58,206,025 (GRCm39) missense probably benign 0.00
R8669:Svep1 UTSW 4 58,070,119 (GRCm39) missense possibly damaging 0.95
R8707:Svep1 UTSW 4 58,070,197 (GRCm39) nonsense probably null
R8790:Svep1 UTSW 4 58,118,145 (GRCm39) missense possibly damaging 0.53
R8804:Svep1 UTSW 4 58,206,043 (GRCm39) missense possibly damaging 0.86
R8868:Svep1 UTSW 4 58,135,578 (GRCm39) missense possibly damaging 0.77
R8880:Svep1 UTSW 4 58,064,204 (GRCm39) missense possibly damaging 0.51
R8949:Svep1 UTSW 4 58,054,604 (GRCm39) missense possibly damaging 0.85
R9007:Svep1 UTSW 4 58,091,915 (GRCm39) missense possibly damaging 0.86
R9028:Svep1 UTSW 4 58,145,199 (GRCm39) missense possibly damaging 0.92
R9131:Svep1 UTSW 4 58,087,778 (GRCm39) missense possibly damaging 0.71
R9285:Svep1 UTSW 4 58,084,809 (GRCm39) critical splice donor site probably null
R9302:Svep1 UTSW 4 58,120,565 (GRCm39) missense possibly damaging 0.53
R9314:Svep1 UTSW 4 58,070,347 (GRCm39) missense probably damaging 1.00
R9427:Svep1 UTSW 4 58,069,804 (GRCm39) missense possibly damaging 0.71
R9443:Svep1 UTSW 4 58,179,697 (GRCm39) missense possibly damaging 0.95
R9473:Svep1 UTSW 4 58,064,243 (GRCm39) missense probably benign 0.00
R9487:Svep1 UTSW 4 58,070,517 (GRCm39) missense probably benign
R9494:Svep1 UTSW 4 58,070,577 (GRCm39) missense possibly damaging 0.51
R9515:Svep1 UTSW 4 58,084,144 (GRCm39) missense possibly damaging 0.71
R9681:Svep1 UTSW 4 58,084,959 (GRCm39) missense probably damaging 0.98
X0063:Svep1 UTSW 4 58,070,468 (GRCm39) nonsense probably null
Z1176:Svep1 UTSW 4 58,133,415 (GRCm39) missense possibly damaging 0.51
Z1176:Svep1 UTSW 4 58,115,814 (GRCm39) missense possibly damaging 0.93
Z1176:Svep1 UTSW 4 58,111,386 (GRCm39) missense probably damaging 0.97
Z1177:Svep1 UTSW 4 58,206,300 (GRCm39) missense probably damaging 0.99
Z1177:Svep1 UTSW 4 58,115,841 (GRCm39) missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- TGGGCAGCAGACACTGACGAATAC -3'
(R):5'- TCTGGGGTCAAGTCAATGCATGAAG -3'

Sequencing Primer
(F):5'- CAAAGGATTGTCTTTGTAAACTGCC -3'
(R):5'- GTTCTGAAGATCACACAAGAGTATG -3'
Posted On 2013-06-11