Mutagenetix > Incidental Mutations

Incidental Mutation 'R5883:Ric1'

454543

Institutional Source

Beutler Lab

Gene Symbol

Ric1

Ensembl Gene

ENSMUSG00000038658

Gene Name

RAB6A GEF complex partner 1

Synonyms

C030046E11Rik, C130057E09Rik

MMRRC Submission

044086-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.481) question?

Stock #

R5883 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

29522282-29606829 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 29595989 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Asparagine at position 943 (I943N)

Ref Sequence

ENSEMBL: ENSMUSP00000043437 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000043610]

Predicted Effect

probably damaging
Transcript: ENSMUST00000043610
AA Change: I943N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000043437
Gene: ENSMUSG00000038658
AA Change: I943N

Domain	Start	End	E-Value	Type
Blast:WD40	242	278	5e-7	BLAST
SCOP:d1gxra_	254	379	2e-4	SMART
Blast:WD40	285	334	3e-6	BLAST
Blast:WD40	482	520	5e-6	BLAST
low complexity region	642	653	N/A	INTRINSIC
Pfam:RIC1	732	991	1.9e-86	PFAM
low complexity region	1120	1132	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000160452
AA Change: I154N

SMART Domains

Protein: ENSMUSP00000125299
Gene: ENSMUSG00000038658
AA Change: I154N

Domain	Start	End	E-Value	Type
Pfam:RIC1	8	163	1.4e-60	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000161330

SMART Domains

Protein: ENSMUSP00000125709
Gene: ENSMUSG00000038658

Domain	Start	End	E-Value	Type
low complexity region	7	28	N/A	INTRINSIC
low complexity region	142	154	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000161536

Predicted Effect

unknown
Transcript: ENSMUST00000162492
AA Change: I834N

SMART Domains

Protein: ENSMUSP00000124727
Gene: ENSMUSG00000038658
AA Change: I834N

Domain	Start	End	E-Value	Type
Blast:WD40	171	207	4e-7	BLAST
SCOP:d1gxra_	183	308	2e-4	SMART
Blast:WD40	214	263	2e-6	BLAST
low complexity region	534	545	N/A	INTRINSIC
Pfam:RIC1	624	883	1.6e-86	PFAM
low complexity region	1012	1024	N/A	INTRINSIC

Meta Mutation Damage Score

0.7658

Coding Region Coverage

1x: 99.9%
3x: 99.4%
10x: 95.9%
20x: 83.7%

Validation Efficiency

100% (70/70)

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
6430548M08Rik	G	A	8: 120,145,641	V103I	probably damaging	Het
Aass	G	A	6: 23,072,994	T920I	probably benign	Het
Akirin2	A	G	4: 34,565,256	I168V	possibly damaging	Het
Ambn	T	A	5: 88,467,829	Y372*	probably null	Het
Ano3	T	A	2: 110,880,864	E85V	probably null	Het
Bmf	C	T	2: 118,546,966		silent	Het
Bmper	T	A	9: 23,406,674	S530T	probably benign	Het
Bop1	T	C	15: 76,454,849	D383G	probably damaging	Het
Bub1b	T	A	2: 118,609,882	Y156N	probably damaging	Het
Cacna1h	A	G	17: 25,376,922	V1987A	probably benign	Het
Cd84	T	C	1: 171,872,838	V174A	possibly damaging	Het
Cep290	T	A	10: 100,523,399	L997Q	probably benign	Het
Chil4	C	T	3: 106,210,570	R128H	possibly damaging	Het
Cpne3	A	T	4: 19,552,314	V106D	possibly damaging	Het
D6Wsu163e	A	G	6: 126,966,916	E425G	probably damaging	Het
Dlgap1	A	T	17: 70,517,013		probably benign	Het
Dnhd1	C	A	7: 105,720,504	H4379N	probably damaging	Het
Gm10309	A	G	17: 86,498,757		probably benign	Het
Gm6264	G	A	1: 85,171,182		probably benign	Het
Has2	T	A	15: 56,668,063	I419F	possibly damaging	Het
Hscb	A	G	5: 110,839,578	C51R	probably benign	Het
Ighv1-61	T	C	12: 115,359,563	S4G	probably benign	Het
Islr2	G	T	9: 58,198,715	Q465K	probably benign	Het
Jakmip2	T	C	18: 43,581,994	I156V	possibly damaging	Het
Klk1b24	A	G	7: 44,190,363	I49V	probably benign	Het
Krt90	C	T	15: 101,553,219		probably benign	Het
Larp1	C	T	11: 58,042,299	S243F	probably damaging	Het
Lrp4	T	C	2: 91,488,433	Y872H	probably benign	Het
Maip1	T	C	1: 57,407,101	M110T	probably damaging	Het
March7	G	A	2: 60,234,442	R354Q	probably damaging	Het
Med12l	G	T	3: 59,091,468	E605D	probably damaging	Het
Nt5c1a	T	A	4: 123,216,256		probably null	Het
Olfr209	A	T	16: 59,361,715	C168S	probably damaging	Het
Olfr490	C	T	7: 108,286,244	S294N	probably damaging	Het
Olfr531	T	A	7: 140,400,188	Y286F	probably damaging	Het
Pdzd9	T	A	7: 120,668,553	E13V	possibly damaging	Het
Ppip5k2	C	T	1: 97,707,810	A1100T	possibly damaging	Het
Prkdc	C	A	16: 15,715,914	Q1539K	probably benign	Het
Rad54l	C	G	4: 116,099,046		probably benign	Het
Rif1	T	A	2: 52,105,639		probably null	Het
Rpl12	T	C	2: 32,962,524		probably benign	Het
Ryr3	T	C	2: 113,030,292		probably benign	Het
Scarb1	C	A	5: 125,340,907		probably benign	Het
Sox10	T	C	15: 79,156,263	E359G	probably damaging	Het
Taf5	A	G	19: 47,067,789	T9A	unknown	Het
Tmem128	C	T	5: 38,266,541	A33V	possibly damaging	Het
Tox	A	C	4: 6,697,444	V453G	probably benign	Het
Ubxn4	T	A	1: 128,256,130	C76S	probably damaging	Het
Vmn2r100	A	T	17: 19,523,524	Y483F	probably benign	Het
Xkr5	A	G	8: 18,940,790	S154P	probably damaging	Het
Zfp687	T	C	3: 95,012,044	N139S	probably benign	Het

Other mutations in Ric1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00574:Ric1	APN	19	29595362	missense	probably damaging	1.00
IGL00902:Ric1	APN	19	29567231	missense	probably benign	0.05
IGL01405:Ric1	APN	19	29567370	splice site	probably benign
IGL01629:Ric1	APN	19	29603981	missense	probably benign	0.02
IGL01688:Ric1	APN	19	29577614	missense	probably benign	0.00
IGL01966:Ric1	APN	19	29595563	missense	probably benign	0.33
IGL02123:Ric1	APN	19	29594800	missense	probably benign
IGL02590:Ric1	APN	19	29567481	splice site	probably benign
IGL02655:Ric1	APN	19	29595451	missense	probably damaging	1.00
IGL02699:Ric1	APN	19	29522557	missense	possibly damaging	0.51
IGL02718:Ric1	APN	19	29533240	missense	probably damaging	1.00
IGL03026:Ric1	APN	19	29599833	missense	probably benign	0.02
IGL03142:Ric1	APN	19	29600980	missense	possibly damaging	0.89
R0109:Ric1	UTSW	19	29586677	synonymous	silent
R0336:Ric1	UTSW	19	29587793	missense	probably damaging	0.96
R0362:Ric1	UTSW	19	29601011	critical splice donor site	probably null
R0676:Ric1	UTSW	19	29577647	missense	probably benign
R0734:Ric1	UTSW	19	29594818	missense	possibly damaging	0.66
R1004:Ric1	UTSW	19	29602357	missense	probably benign	0.00
R1148:Ric1	UTSW	19	29579849	missense	probably benign
R1148:Ric1	UTSW	19	29579849	missense	probably benign
R1216:Ric1	UTSW	19	29577735	missense	probably benign	0.00
R1493:Ric1	UTSW	19	29579849	missense	probably benign
R1848:Ric1	UTSW	19	29600813	splice site	probably null
R1872:Ric1	UTSW	19	29602668	missense	probably benign	0.32
R1942:Ric1	UTSW	19	29601016	splice site	probably benign
R2143:Ric1	UTSW	19	29533252	missense	probably damaging	1.00
R2143:Ric1	UTSW	19	29533253	missense	probably damaging	0.96
R2679:Ric1	UTSW	19	29604030	missense	probably benign
R2878:Ric1	UTSW	19	29602330	missense	possibly damaging	0.77
R2970:Ric1	UTSW	19	29577718	missense	probably benign	0.15
R3420:Ric1	UTSW	19	29567590	missense	probably damaging	0.96
R3421:Ric1	UTSW	19	29567590	missense	probably damaging	0.96
R3940:Ric1	UTSW	19	29570762	missense	probably damaging	1.00
R4004:Ric1	UTSW	19	29579801	missense	probably benign	0.44
R4225:Ric1	UTSW	19	29602731	missense	possibly damaging	0.89
R4280:Ric1	UTSW	19	29586550	missense	probably damaging	1.00
R4283:Ric1	UTSW	19	29586550	missense	probably damaging	1.00
R4516:Ric1	UTSW	19	29570765	missense	probably benign	0.17
R4702:Ric1	UTSW	19	29598017	missense	possibly damaging	0.85
R4824:Ric1	UTSW	19	29585842	missense	probably damaging	1.00
R4835:Ric1	UTSW	19	29595536	missense	possibly damaging	0.80
R5860:Ric1	UTSW	19	29599845	missense	possibly damaging	0.91
R5965:Ric1	UTSW	19	29570771	missense	probably damaging	0.99
R6141:Ric1	UTSW	19	29595442	missense	probably damaging	1.00
R6236:Ric1	UTSW	19	29595426	missense	possibly damaging	0.91
R6271:Ric1	UTSW	19	29567365	splice site	probably null
R6345:Ric1	UTSW	19	29604085	missense	probably benign	0.09
R6371:Ric1	UTSW	19	29562026	missense	probably benign	0.35
R6547:Ric1	UTSW	19	29594826	missense	probably damaging	1.00
R6924:Ric1	UTSW	19	29569388	missense	probably damaging	0.98
R6969:Ric1	UTSW	19	29585782	missense	probably damaging	1.00
R6970:Ric1	UTSW	19	29587772	missense	probably damaging	1.00
R6993:Ric1	UTSW	19	29586613	missense	probably damaging	1.00
R7296:Ric1	UTSW	19	29584578	critical splice donor site	probably null
R7434:Ric1	UTSW	19	29574780	missense	probably damaging	1.00
R7619:Ric1	UTSW	19	29579775	missense	probably benign	0.32
R7850:Ric1	UTSW	19	29594893	missense	probably benign
R7933:Ric1	UTSW	19	29594893	missense	probably benign
X0064:Ric1	UTSW	19	29587802	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGCTGGAGGAAGAAGCTACC -3'
(R):5'- ACTTGGCAAGTCTGAGTTCTTTAG -3'

Sequencing Primer
(F):5'- AGGAAGAAGCTACCTCCCGG -3'
(R):5'- TTTAGAATGAAAGACATACACCACAG -3'

Posted On

2017-02-10