Incidental Mutation 'R5884:Matn4'
ID454553
Institutional Source Beutler Lab
Gene Symbol Matn4
Ensembl Gene ENSMUSG00000016995
Gene Namematrilin 4
Synonymsmatrilin-4
MMRRC Submission 044087-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5884 (G1)
Quality Score99
Status Validated
Chromosome2
Chromosomal Location164389393-164405160 bp(-) (GRCm38)
Type of Mutationutr 5 prime
DNA Base Change (assembly) A to T at 164404608 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000104983 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017151] [ENSMUST00000103103] [ENSMUST00000103104] [ENSMUST00000109358] [ENSMUST00000109359]
Predicted Effect probably benign
Transcript: ENSMUST00000017151
SMART Domains Protein: ENSMUSP00000017151
Gene: ENSMUSG00000017007

DomainStartEndE-ValueType
LAG1_DNAbind 66 204 4.58e-78 SMART
BTD 205 357 1.23e-83 SMART
SCOP:d1a02n1 383 475 3e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000103103
SMART Domains Protein: ENSMUSP00000099392
Gene: ENSMUSG00000016995

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
VWA 34 209 8.6e-54 SMART
EGF 220 257 1.04e-3 SMART
EGF 261 298 3.43e-4 SMART
EGF 302 339 1.85e0 SMART
EGF 343 380 1.24e-1 SMART
VWA 386 564 6.72e-56 SMART
Matrilin_ccoil 574 621 2.39e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000103104
SMART Domains Protein: ENSMUSP00000099393
Gene: ENSMUSG00000016995

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
VWA 34 209 8.6e-54 SMART
EGF 220 257 1.04e-3 SMART
EGF 261 298 3.43e-4 SMART
EGF 302 339 1.85e0 SMART
EGF 343 380 1.24e-1 SMART
VWA 386 564 6.72e-56 SMART
Matrilin_ccoil 574 621 2.39e-14 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000109356
Predicted Effect probably benign
Transcript: ENSMUST00000109358
SMART Domains Protein: ENSMUSP00000104982
Gene: ENSMUSG00000016995

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
VWA 34 209 8.6e-54 SMART
EGF 220 257 1.85e0 SMART
EGF 261 298 1.24e-1 SMART
VWA 304 482 6.72e-56 SMART
Matrilin_ccoil 492 539 2.39e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109359
SMART Domains Protein: ENSMUSP00000104983
Gene: ENSMUSG00000016995

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
VWA 34 209 8.6e-54 SMART
EGF 220 257 3.43e-4 SMART
EGF 261 298 1.85e0 SMART
EGF 302 339 1.24e-1 SMART
VWA 345 523 6.72e-56 SMART
Matrilin_ccoil 533 580 2.39e-14 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137427
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154940
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 95.6%
  • 20x: 82.8%
Validation Efficiency 96% (66/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of von Willebrand factor A domain-containing protein family. The proteins of this family are thought to be involved in the formation of filamentous networks in the extracellular matrices of various tissues. This family member is thought to be play a role in reorganizing and regenerating the corneal matrix in granular and lattice type I dystrophies. It may also be involved in wound healing in the dentin-pulp complex. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2013]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bmp5 T C 9: 75,898,554 M446T probably damaging Het
Cacna1g C T 11: 94,437,867 A1052T probably damaging Het
Cand1 C T 10: 119,213,765 A359T possibly damaging Het
Ccne2 A T 4: 11,199,411 T271S probably benign Het
Cep112 A G 11: 108,570,316 T546A probably damaging Het
Ces1g A G 8: 93,306,930 S455P probably benign Het
Dnah11 A T 12: 118,177,534 C496S probably benign Het
Dtx3l C G 16: 35,932,233 E668Q probably benign Het
Dysf T A 6: 84,186,081 F1579I probably damaging Het
Emx2 T G 19: 59,464,029 D248E probably damaging Het
Eri2 A C 7: 119,772,329 *275E probably null Het
F5 G A 1: 164,195,646 R1591H probably benign Het
Fabp3 A G 4: 130,312,338 T41A probably benign Het
Fam89a C T 8: 124,751,769 R14H probably damaging Het
Gbe1 T A 16: 70,528,875 probably null Het
Gm7102 C T 19: 61,175,926 G24R unknown Het
Golga3 A G 5: 110,216,895 E1211G probably damaging Het
Gpa33 T C 1: 166,152,760 S131P probably damaging Het
Hyal6 T C 6: 24,743,369 Y355H probably damaging Het
Ide A T 19: 37,272,153 probably null Het
Ighv5-21 A T 12: 114,320,186 probably benign Het
Iglc1 A T 16: 19,061,991 probably benign Het
Impa1 A T 3: 10,316,224 N199K probably damaging Het
Irx5 A C 8: 92,360,630 T397P possibly damaging Het
Kdelc1 T C 1: 44,117,100 N109S probably benign Het
Lonp2 A G 8: 86,641,626 Y356C probably damaging Het
Nav2 T A 7: 49,597,169 Y2147* probably null Het
Nek5 C T 8: 22,088,801 probably null Het
Olfr1014 T A 2: 85,777,055 I157K probably damaging Het
Olfr1164 A G 2: 88,093,796 Y47H probably damaging Het
Olfr1348 C A 7: 6,501,843 V128L probably benign Het
Omt2b A G 9: 78,328,557 M55V probably benign Het
Parp4 T A 14: 56,614,750 H796Q probably damaging Het
Pex2 T C 3: 5,561,299 E150G probably benign Het
Psmb2 T A 4: 126,684,221 V64E possibly damaging Het
Psmd6 C T 14: 14,116,526 R63H probably damaging Het
Ptprd A G 4: 75,982,690 Y1061H probably damaging Het
Rab23 A G 1: 33,724,886 probably benign Het
Rad51ap2 GAAAAGGAAACTATTTAAAA GAAAA 12: 11,457,533 probably benign Het
Reg1 C T 6: 78,428,217 S141L possibly damaging Het
Rock1 A T 18: 10,099,361 I680K probably benign Het
Sez6l2 A G 7: 126,970,156 probably benign Het
Slc34a2 A T 5: 53,069,380 Q615L possibly damaging Het
Slu7 A G 11: 43,443,418 K424E probably benign Het
Tctn2 A T 5: 124,603,832 noncoding transcript Het
Tmem87a T A 2: 120,404,124 probably benign Het
Trappc4 A G 9: 44,404,088 F198L probably damaging Het
Usp33 C T 3: 152,368,330 T271I probably benign Het
Vmn1r15 T A 6: 57,259,008 I287K probably damaging Het
Vmn2r75 A C 7: 86,165,370 I305R probably benign Het
Wdr26 T C 1: 181,187,541 probably benign Het
Zzz3 T C 3: 152,450,658 S684P probably damaging Het
Other mutations in Matn4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01745:Matn4 APN 2 164400743 missense probably damaging 0.97
IGL02188:Matn4 APN 2 164400866 missense probably benign 0.00
IGL02195:Matn4 APN 2 164401052 missense probably damaging 1.00
IGL02696:Matn4 APN 2 164396838 missense probably benign 0.09
IGL02927:Matn4 APN 2 164389837 missense probably damaging 1.00
R2021:Matn4 UTSW 2 164400653 missense probably damaging 1.00
R2022:Matn4 UTSW 2 164400653 missense probably damaging 1.00
R2272:Matn4 UTSW 2 164397242 missense possibly damaging 0.92
R2448:Matn4 UTSW 2 164401850 missense probably benign 0.04
R4824:Matn4 UTSW 2 164393231 missense probably benign 0.01
R4839:Matn4 UTSW 2 164400976 missense probably benign 0.00
R5914:Matn4 UTSW 2 164393224 missense probably damaging 1.00
R6209:Matn4 UTSW 2 164400815 missense probably damaging 1.00
R6995:Matn4 UTSW 2 164389664 nonsense probably null
R7679:Matn4 UTSW 2 164389658 makesense probably null
R8035:Matn4 UTSW 2 164397040 missense probably damaging 0.99
R8117:Matn4 UTSW 2 164392931 missense probably damaging 1.00
R8117:Matn4 UTSW 2 164399762 missense probably benign 0.05
X0063:Matn4 UTSW 2 164397277 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGGCTGTTAAGACTTGTCCC -3'
(R):5'- TCCAGCTGTAGCCCAATTCC -3'

Sequencing Primer
(F):5'- AAGACTTGTCCCCCTACGG -3'
(R):5'- CCAATTCCGGCCCGCAG -3'
Posted On2017-02-10